Incidental Mutation 'R7633:Synpo'
ID 589787
Institutional Source Beutler Lab
Gene Symbol Synpo
Ensembl Gene ENSMUSG00000043079
Gene Name synaptopodin
Synonyms 9030217H17Rik, 9330140I15Rik
MMRRC Submission 045721-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.250) question?
Stock # R7633 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 60727045-60793214 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 60736500 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 482 (T482I)
Ref Sequence ENSEMBL: ENSMUSP00000115355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097566] [ENSMUST00000115318] [ENSMUST00000123288] [ENSMUST00000130044] [ENSMUST00000130360] [ENSMUST00000143275] [ENSMUST00000155195]
AlphaFold Q8CC35
Predicted Effect probably damaging
Transcript: ENSMUST00000097566
AA Change: T243I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095174
Gene: ENSMUSG00000043079
AA Change: T243I

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
low complexity region 714 741 N/A INTRINSIC
low complexity region 769 782 N/A INTRINSIC
low complexity region 786 811 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115318
AA Change: T243I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110973
Gene: ENSMUSG00000043079
AA Change: T243I

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123288
Predicted Effect probably damaging
Transcript: ENSMUST00000130044
AA Change: T243I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121756
Gene: ENSMUSG00000043079
AA Change: T243I

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
low complexity region 714 741 N/A INTRINSIC
low complexity region 769 782 N/A INTRINSIC
low complexity region 786 811 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130360
AA Change: T482I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115355
Gene: ENSMUSG00000043079
AA Change: T482I

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 667 685 N/A INTRINSIC
low complexity region 810 839 N/A INTRINSIC
low complexity region 846 867 N/A INTRINSIC
low complexity region 913 940 N/A INTRINSIC
low complexity region 968 981 N/A INTRINSIC
low complexity region 985 1010 N/A INTRINSIC
low complexity region 1029 1045 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143275
AA Change: T482I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125272
Gene: ENSMUSG00000043079
AA Change: T482I

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 667 685 N/A INTRINSIC
low complexity region 810 839 N/A INTRINSIC
low complexity region 846 867 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155195
AA Change: T243I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117897
Gene: ENSMUSG00000043079
AA Change: T243I

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Synaptopodin is an actin-associated protein that may play a role in actin-based cell shape and motility. The name synaptopodin derives from the protein's associations with postsynaptic densities and dendritic spines and with renal podocytes (Mundel et al., 1997 [PubMed 9314539]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in telencephalic neurons, reduced long term potentiation, and behavioral abnormalities including hypoactivity, reduced anxiety, and learning deficiencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,742,978 (GRCm39) R92S unknown Het
Acaca A G 11: 84,263,465 (GRCm39) I2029V probably benign Het
Anks1b A C 10: 90,784,446 (GRCm39) D1138A probably damaging Het
Atr T A 9: 95,829,171 (GRCm39) V2508E probably damaging Het
C4b C T 17: 34,948,373 (GRCm39) probably null Het
Calhm4 G A 10: 33,919,904 (GRCm39) T121M possibly damaging Het
Cd46 A T 1: 194,765,927 (GRCm39) M146K probably null Het
Chp1 A G 2: 119,391,226 (GRCm39) I28V probably benign Het
Chrnb1 T A 11: 69,683,699 (GRCm39) R216W probably damaging Het
Clmn G A 12: 104,748,371 (GRCm39) T392M probably benign Het
Cracd A G 5: 77,005,367 (GRCm39) E576G unknown Het
Dcxr A C 11: 120,617,279 (GRCm39) L88R probably benign Het
Dedd C T 1: 171,166,478 (GRCm39) P138L probably benign Het
Degs1 A G 1: 182,107,263 (GRCm39) S35P probably damaging Het
Ehmt1 T C 2: 24,705,792 (GRCm39) D851G possibly damaging Het
Fam117b A G 1: 60,020,693 (GRCm39) D521G probably damaging Het
Gm6882 A G 7: 21,161,577 (GRCm39) V97A probably damaging Het
Hgs A T 11: 120,365,128 (GRCm39) Q172L probably damaging Het
Hormad2 T C 11: 4,296,662 (GRCm39) Q274R probably benign Het
Igkv8-19 C T 6: 70,318,383 (GRCm39) probably benign Het
Ikbkb T C 8: 23,161,757 (GRCm39) N377S probably benign Het
Intu G A 3: 40,608,683 (GRCm39) G232S probably damaging Het
Lypd9 C A 11: 58,338,304 (GRCm39) M29I probably benign Het
Mov10 A G 3: 104,704,381 (GRCm39) S806P possibly damaging Het
Mrgprb1 A G 7: 48,097,331 (GRCm39) F194L probably benign Het
Notch3 A T 17: 32,377,596 (GRCm39) I160K probably benign Het
Nup155 C G 15: 8,138,937 (GRCm39) S3W probably damaging Het
Or4k41 A G 2: 111,279,967 (GRCm39) I161V probably benign Het
Or8s5 A G 15: 98,237,967 (GRCm39) I301T probably damaging Het
Plxdc1 A T 11: 97,846,977 (GRCm39) F147L possibly damaging Het
Ppfia1 T C 7: 144,106,173 (GRCm39) D33G possibly damaging Het
Prdm11 G A 2: 92,810,999 (GRCm39) A200V probably damaging Het
Qrich2 A T 11: 116,347,455 (GRCm39) I1123K unknown Het
Rgs1 A G 1: 144,124,215 (GRCm39) probably null Het
Skint7 T A 4: 111,841,337 (GRCm39) V259E probably benign Het
Slc25a3 A T 10: 90,953,904 (GRCm39) probably null Het
Slc28a2b A T 2: 122,317,161 (GRCm39) R7S probably null Het
Slco1a6 A T 6: 142,091,481 (GRCm39) I73N probably damaging Het
Sltm C G 9: 70,493,955 (GRCm39) P802R possibly damaging Het
Smc4 CTA CTATA 3: 68,925,400 (GRCm39) probably benign Het
Spock2 G A 10: 59,962,002 (GRCm39) D206N probably damaging Het
Stard3nl T G 13: 19,552,008 (GRCm39) R185S probably damaging Het
Supt16 A G 14: 52,434,556 (GRCm39) Y18H probably benign Het
Tcstv7b G A 13: 120,702,376 (GRCm39) W57* probably null Het
Tmc6 G T 11: 117,660,046 (GRCm39) T694K probably benign Het
Trim59 T A 3: 68,945,259 (GRCm39) H27L probably damaging Het
Trpv2 G A 11: 62,481,832 (GRCm39) probably null Het
Tyw5 A T 1: 57,432,644 (GRCm39) D117E probably benign Het
Usp17la T C 7: 104,510,354 (GRCm39) Y320H probably damaging Het
Usp31 T C 7: 121,258,185 (GRCm39) D694G probably damaging Het
Vmn1r159 T A 7: 22,542,448 (GRCm39) T195S probably damaging Het
Vmn2r57 C T 7: 41,074,513 (GRCm39) V517M possibly damaging Het
Yipf1 A G 4: 107,176,193 (GRCm39) N29S probably benign Het
Zfp954 A T 7: 7,118,823 (GRCm39) F240L possibly damaging Het
Other mutations in Synpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Synpo APN 18 60,737,149 (GRCm39) missense probably damaging 1.00
IGL00976:Synpo APN 18 60,736,491 (GRCm39) missense possibly damaging 0.74
IGL01808:Synpo APN 18 60,735,280 (GRCm39) missense probably benign 0.01
IGL02116:Synpo APN 18 60,736,528 (GRCm39) missense probably damaging 1.00
IGL02444:Synpo APN 18 60,735,502 (GRCm39) missense probably damaging 1.00
IGL02838:Synpo APN 18 60,736,872 (GRCm39) missense probably damaging 1.00
R0420:Synpo UTSW 18 60,735,490 (GRCm39) missense probably damaging 0.97
R0650:Synpo UTSW 18 60,735,412 (GRCm39) missense possibly damaging 0.83
R0790:Synpo UTSW 18 60,736,575 (GRCm39) missense probably damaging 0.98
R1213:Synpo UTSW 18 60,735,525 (GRCm39) missense possibly damaging 0.83
R1695:Synpo UTSW 18 60,736,459 (GRCm39) missense probably benign 0.00
R1763:Synpo UTSW 18 60,735,856 (GRCm39) missense probably damaging 1.00
R1920:Synpo UTSW 18 60,736,661 (GRCm39) missense probably benign 0.00
R1921:Synpo UTSW 18 60,736,661 (GRCm39) missense probably benign 0.00
R2133:Synpo UTSW 18 60,735,967 (GRCm39) missense probably damaging 1.00
R3757:Synpo UTSW 18 60,736,062 (GRCm39) missense probably damaging 1.00
R4796:Synpo UTSW 18 60,737,386 (GRCm39) missense probably damaging 0.97
R4841:Synpo UTSW 18 60,736,684 (GRCm39) missense probably damaging 0.99
R4842:Synpo UTSW 18 60,736,684 (GRCm39) missense probably damaging 0.99
R4911:Synpo UTSW 18 60,762,936 (GRCm39) utr 5 prime probably benign
R5091:Synpo UTSW 18 60,735,831 (GRCm39) nonsense probably null
R5327:Synpo UTSW 18 60,736,918 (GRCm39) missense possibly damaging 0.93
R5354:Synpo UTSW 18 60,735,303 (GRCm39) critical splice donor site probably null
R5671:Synpo UTSW 18 60,729,022 (GRCm39) missense probably damaging 0.99
R5868:Synpo UTSW 18 60,737,118 (GRCm39) missense probably damaging 1.00
R6007:Synpo UTSW 18 60,736,687 (GRCm39) missense probably benign 0.35
R7266:Synpo UTSW 18 60,762,631 (GRCm39) missense probably benign 0.00
R7472:Synpo UTSW 18 60,762,895 (GRCm39) missense probably benign 0.00
R7509:Synpo UTSW 18 60,736,566 (GRCm39) missense probably damaging 1.00
R7554:Synpo UTSW 18 60,736,405 (GRCm39) missense probably benign 0.21
R7584:Synpo UTSW 18 60,729,349 (GRCm39) missense probably damaging 0.96
R7615:Synpo UTSW 18 60,737,547 (GRCm39) missense probably damaging 1.00
R8499:Synpo UTSW 18 60,736,044 (GRCm39) missense probably damaging 1.00
R8512:Synpo UTSW 18 60,735,483 (GRCm39) missense probably damaging 0.99
R8996:Synpo UTSW 18 60,737,230 (GRCm39) missense possibly damaging 0.95
R9116:Synpo UTSW 18 60,735,599 (GRCm39) missense probably damaging 0.98
R9336:Synpo UTSW 18 60,735,472 (GRCm39) missense probably damaging 0.96
R9798:Synpo UTSW 18 60,736,832 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GACAAAGTCTCCGCATAGGTG -3'
(R):5'- TGCTCATTGACATGCAGCC -3'

Sequencing Primer
(F):5'- AAATTTCCTAAGGGGCGTCTC -3'
(R):5'- TGCAGCCTAGCACCCTAG -3'
Posted On 2019-10-24