Incidental Mutation 'R7633:Synpo'
ID589787
Institutional Source Beutler Lab
Gene Symbol Synpo
Ensembl Gene ENSMUSG00000043079
Gene Namesynaptopodin
Synonyms9030217H17Rik, 9330140I15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R7633 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location60593973-60660142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60603428 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 482 (T482I)
Ref Sequence ENSEMBL: ENSMUSP00000115355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097566] [ENSMUST00000115318] [ENSMUST00000123288] [ENSMUST00000130044] [ENSMUST00000130360] [ENSMUST00000143275] [ENSMUST00000155195]
Predicted Effect probably damaging
Transcript: ENSMUST00000097566
AA Change: T243I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095174
Gene: ENSMUSG00000043079
AA Change: T243I

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
low complexity region 714 741 N/A INTRINSIC
low complexity region 769 782 N/A INTRINSIC
low complexity region 786 811 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115318
AA Change: T243I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110973
Gene: ENSMUSG00000043079
AA Change: T243I

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123288
Predicted Effect probably damaging
Transcript: ENSMUST00000130044
AA Change: T243I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121756
Gene: ENSMUSG00000043079
AA Change: T243I

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
low complexity region 714 741 N/A INTRINSIC
low complexity region 769 782 N/A INTRINSIC
low complexity region 786 811 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130360
AA Change: T482I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115355
Gene: ENSMUSG00000043079
AA Change: T482I

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 667 685 N/A INTRINSIC
low complexity region 810 839 N/A INTRINSIC
low complexity region 846 867 N/A INTRINSIC
low complexity region 913 940 N/A INTRINSIC
low complexity region 968 981 N/A INTRINSIC
low complexity region 985 1010 N/A INTRINSIC
low complexity region 1029 1045 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143275
AA Change: T482I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125272
Gene: ENSMUSG00000043079
AA Change: T482I

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 667 685 N/A INTRINSIC
low complexity region 810 839 N/A INTRINSIC
low complexity region 846 867 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155195
AA Change: T243I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117897
Gene: ENSMUSG00000043079
AA Change: T243I

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Synaptopodin is an actin-associated protein that may play a role in actin-based cell shape and motility. The name synaptopodin derives from the protein's associations with postsynaptic densities and dendritic spines and with renal podocytes (Mundel et al., 1997 [PubMed 9314539]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in telencephalic neurons, reduced long term potentiation, and behavioral abnormalities including hypoactivity, reduced anxiety, and learning deficiencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930504O13Rik C A 11: 58,447,478 M29I probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Acaca A G 11: 84,372,639 I2029V probably benign Het
Anks1b A C 10: 90,948,584 D1138A probably damaging Het
Atr T A 9: 95,947,118 V2508E probably damaging Het
C4b C T 17: 34,729,399 probably null Het
C530008M17Rik A G 5: 76,857,520 E576G unknown Het
Cd46 A T 1: 195,083,619 M146K probably null Het
Chp1 A G 2: 119,560,745 I28V probably benign Het
Chrnb1 T A 11: 69,792,873 R216W probably damaging Het
Clmn G A 12: 104,782,112 T392M probably benign Het
Dcxr A C 11: 120,726,453 L88R probably benign Het
Dedd C T 1: 171,338,910 P138L probably benign Het
Degs1 A G 1: 182,279,698 S35P probably damaging Het
Ehmt1 T C 2: 24,815,780 D851G possibly damaging Het
Fam117b A G 1: 59,981,534 D521G probably damaging Het
Fam26d G A 10: 34,043,908 T121M possibly damaging Het
Gm14085 A T 2: 122,486,680 R7S probably null Het
Gm21731 G A 13: 120,240,840 W57* probably null Het
Gm6882 A G 7: 21,427,652 V97A probably damaging Het
Hgs A T 11: 120,474,302 Q172L probably damaging Het
Hormad2 T C 11: 4,346,662 Q274R probably benign Het
Igkv8-19 C T 6: 70,341,399 probably benign Het
Ikbkb T C 8: 22,671,741 N377S probably benign Het
Intu G A 3: 40,654,253 G232S probably damaging Het
Mov10 A G 3: 104,797,065 S806P possibly damaging Het
Mrgprb1 A G 7: 48,447,583 F194L probably benign Het
Notch3 A T 17: 32,158,622 I160K probably benign Het
Nup155 C G 15: 8,109,453 S3W probably damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr284 A G 15: 98,340,086 I301T probably damaging Het
Plxdc1 A T 11: 97,956,151 F147L possibly damaging Het
Ppfia1 T C 7: 144,552,436 D33G possibly damaging Het
Prdm11 G A 2: 92,980,654 A200V probably damaging Het
Qrich2 A T 11: 116,456,629 I1123K unknown Het
Rgs1 A G 1: 144,248,477 probably null Het
Skint7 T A 4: 111,984,140 V259E probably benign Het
Slc25a3 A T 10: 91,118,042 probably null Het
Slco1a6 A T 6: 142,145,755 I73N probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Spock2 G A 10: 60,126,180 D206N probably damaging Het
Stard3nl T G 13: 19,367,838 R185S probably damaging Het
Supt16 A G 14: 52,197,099 Y18H probably benign Het
Tmc6 G T 11: 117,769,220 T694K probably benign Het
Trim59 T A 3: 69,037,926 H27L probably damaging Het
Trpv2 G A 11: 62,591,006 probably null Het
Tyw5 A T 1: 57,393,485 D117E probably benign Het
Usp17la T C 7: 104,861,147 Y320H probably damaging Het
Usp31 T C 7: 121,658,962 D694G probably damaging Het
Vmn1r159 T A 7: 22,843,023 T195S probably damaging Het
Vmn2r57 C T 7: 41,425,089 V517M possibly damaging Het
Yipf1 A G 4: 107,318,996 N29S probably benign Het
Zfp954 A T 7: 7,115,824 F240L possibly damaging Het
Other mutations in Synpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Synpo APN 18 60604077 missense probably damaging 1.00
IGL00976:Synpo APN 18 60603419 missense possibly damaging 0.74
IGL01808:Synpo APN 18 60602208 missense probably benign 0.01
IGL02116:Synpo APN 18 60603456 missense probably damaging 1.00
IGL02444:Synpo APN 18 60602430 missense probably damaging 1.00
IGL02838:Synpo APN 18 60603800 missense probably damaging 1.00
R0420:Synpo UTSW 18 60602418 missense probably damaging 0.97
R0650:Synpo UTSW 18 60602340 missense possibly damaging 0.83
R0790:Synpo UTSW 18 60603503 missense probably damaging 0.98
R1213:Synpo UTSW 18 60602453 missense possibly damaging 0.83
R1695:Synpo UTSW 18 60603387 missense probably benign 0.00
R1763:Synpo UTSW 18 60602784 missense probably damaging 1.00
R1920:Synpo UTSW 18 60603589 missense probably benign 0.00
R1921:Synpo UTSW 18 60603589 missense probably benign 0.00
R2133:Synpo UTSW 18 60602895 missense probably damaging 1.00
R3757:Synpo UTSW 18 60602990 missense probably damaging 1.00
R4796:Synpo UTSW 18 60604314 missense probably damaging 0.97
R4841:Synpo UTSW 18 60603612 missense probably damaging 0.99
R4842:Synpo UTSW 18 60603612 missense probably damaging 0.99
R4911:Synpo UTSW 18 60629864 utr 5 prime probably benign
R5091:Synpo UTSW 18 60602759 nonsense probably null
R5327:Synpo UTSW 18 60603846 missense possibly damaging 0.93
R5354:Synpo UTSW 18 60602231 critical splice donor site probably null
R5671:Synpo UTSW 18 60595950 missense probably damaging 0.99
R5868:Synpo UTSW 18 60604046 missense probably damaging 1.00
R6007:Synpo UTSW 18 60603615 missense probably benign 0.35
R7266:Synpo UTSW 18 60629559 missense probably benign 0.00
R7472:Synpo UTSW 18 60629823 missense probably benign 0.00
R7509:Synpo UTSW 18 60603494 missense probably damaging 1.00
R7554:Synpo UTSW 18 60603333 missense probably benign 0.21
R7584:Synpo UTSW 18 60596277 missense probably damaging 0.96
R7615:Synpo UTSW 18 60604475 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAAAGTCTCCGCATAGGTG -3'
(R):5'- TGCTCATTGACATGCAGCC -3'

Sequencing Primer
(F):5'- AAATTTCCTAAGGGGCGTCTC -3'
(R):5'- TGCAGCCTAGCACCCTAG -3'
Posted On2019-10-24