Incidental Mutation 'R7634:Cfap65'
ID589788
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Namecilia and flagella associated protein 65
SynonymsCcdc108, B230363K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R7634 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location74902071-74935599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 74902434 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1780 (N1780K)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
Predicted Effect probably damaging
Transcript: ENSMUST00000094844
AA Change: N1780K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: N1780K

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat A T 8: 60,516,068 M116L probably benign Het
Adam25 A G 8: 40,754,846 D383G probably benign Het
Adam26b T A 8: 43,520,997 M323L probably benign Het
Adgrf3 T C 5: 30,202,247 H227R probably benign Het
Antxr1 G A 6: 87,137,291 T498I probably benign Het
Arg1 T A 10: 24,915,729 T285S possibly damaging Het
Arhgdig T C 17: 26,199,391 D206G probably damaging Het
Asb10 C A 5: 24,540,877 C17F possibly damaging Het
Atg2b T C 12: 105,652,120 D891G probably damaging Het
Cacna1h A T 17: 25,392,109 S572T possibly damaging Het
Cenpj T C 14: 56,542,800 T985A probably benign Het
Cyp26c1 T C 19: 37,692,999 Y417H probably damaging Het
Dnajb13 G T 7: 100,503,186 Q308K probably benign Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm13762 G T 2: 88,973,657 P78Q probably damaging Het
Gm14025 T A 2: 129,038,272 D578V Het
Gm3127 A G 14: 4,166,014 N64S probably damaging Het
Gm4847 A C 1: 166,632,680 N412K probably benign Het
Gtf3c3 A T 1: 54,419,641 probably null Het
Guf1 T C 5: 69,564,544 S349P probably damaging Het
Hvcn1 A G 5: 122,233,523 Y42C probably damaging Het
Insm1 A G 2: 146,223,107 Y281C probably damaging Het
Lrrc71 A G 3: 87,742,974 I264T probably damaging Het
Lrriq1 T C 10: 103,200,601 N897S probably damaging Het
Mtmr6 T A 14: 60,296,147 F375I probably damaging Het
Mtor G C 4: 148,452,350 S27T possibly damaging Het
Mylk4 T A 13: 32,708,908 K387N possibly damaging Het
Nadk2 T G 15: 9,092,846 D247E probably benign Het
Nfya T C 17: 48,392,417 T213A probably damaging Het
Nlrp1a A G 11: 71,099,528 V1067A probably benign Het
Nrbp2 C T 15: 76,087,408 R206Q possibly damaging Het
Oas2 A G 5: 120,733,228 V722A probably benign Het
Pcdhb2 G T 18: 37,294,947 probably benign Het
Pdpr T A 8: 111,125,685 H561Q probably damaging Het
Plcz1 A G 6: 140,016,127 F233L probably damaging Het
Ppp1r3d A G 2: 178,413,372 I279T probably damaging Het
Psg17 A G 7: 18,814,491 Y452H probably damaging Het
Reg4 T C 3: 98,233,112 probably null Het
Rint1 A G 5: 23,805,479 T229A probably benign Het
Robo1 T G 16: 73,042,978 probably null Het
Slc22a26 A C 19: 7,802,587 probably null Het
Slc22a7 C T 17: 46,438,230 A54T probably benign Het
Slc52a3 C A 2: 152,004,614 T165N possibly damaging Het
Slc7a11 C T 3: 50,424,037 probably null Het
Smap2 T C 4: 121,016,799 N18S probably benign Het
Spag6l T C 16: 16,777,414 E369G probably damaging Het
Tarsl2 T A 7: 65,676,012 Y445N probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmprss7 C T 16: 45,663,274 G579D probably benign Het
Tpi1 T A 6: 124,812,854 K109* probably null Het
Ttc25 G A 11: 100,561,905 probably null Het
Ttn T C 2: 76,798,512 E14466G possibly damaging Het
Usp40 A T 1: 87,962,430 C903* probably null Het
Vmn2r104 T A 17: 20,041,709 L386F possibly damaging Het
Vmn2r54 G A 7: 12,615,703 P651S probably damaging Het
Wnk4 C A 11: 101,262,895 T261K probably damaging Het
Wnt2b T C 3: 104,947,116 Y342C probably damaging Het
Zbtb8b A G 4: 129,432,962 Y137H probably damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
R8344:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8345:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8413:Cfap65 UTSW 1 74917169 nonsense probably null
R8431:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8432:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8528:Cfap65 UTSW 1 74905937 missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74903223 missense probably benign 0.43
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTGTGACATCTGCAAGAGG -3'
(R):5'- AGTGTTGCCACCAGAAGCAG -3'

Sequencing Primer
(F):5'- ACATCTGCAAGAGGTTGTCTGTCC -3'
(R):5'- AGCAGGGCTTTCCGTGG -3'
Posted On2019-10-24