Mutagenetix > Incidental Mutation

Incidental Mutation 'R7634:Cfap65'

589788

Institutional Source

Beutler Lab

Gene Symbol

Cfap65

Ensembl Gene

ENSMUSG00000047021

Gene Name

cilia and flagella associated protein 65

Synonyms

Ccdc108, B230363K08Rik

MMRRC Submission

045693-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.621) question?

Stock #

R7634 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74902071-74935599 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 74902434 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1780 (N1780K)

Ref Sequence

ENSEMBL: ENSMUSP00000092440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094844]

AlphaFold

Q3V0B4

Predicted Effect

probably damaging
Transcript: ENSMUST00000094844
AA Change: N1780K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: N1780K

Domain	Start	End	E-Value	Type
transmembrane domain	111	133	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
internal_repeat_1	745	890	9.31e-5	PROSPERO
internal_repeat_1	1167	1322	9.31e-5	PROSPERO
low complexity region	1350	1361	N/A	INTRINSIC
low complexity region	1574	1592	N/A	INTRINSIC
coiled coil region	1687	1724	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadat	A	T	8: 60,516,068	M116L	probably benign	Het
Adam25	A	G	8: 40,754,846	D383G	probably benign	Het
Adam26b	T	A	8: 43,520,997	M323L	probably benign	Het
Adgrf3	T	C	5: 30,202,247	H227R	probably benign	Het
Antxr1	G	A	6: 87,137,291	T498I	probably benign	Het
Arg1	T	A	10: 24,915,729	T285S	possibly damaging	Het
Arhgdig	T	C	17: 26,199,391	D206G	probably damaging	Het
Asb10	C	A	5: 24,540,877	C17F	possibly damaging	Het
Atg2b	T	C	12: 105,652,120	D891G	probably damaging	Het
Cacna1h	A	T	17: 25,392,109	S572T	possibly damaging	Het
Cenpj	T	C	14: 56,542,800	T985A	probably benign	Het
Cyp26c1	T	C	19: 37,692,999	Y417H	probably damaging	Het
Dnajb13	G	T	7: 100,503,186	Q308K	probably benign	Het
Fam107b	T	C	2: 3,770,740	S3P	possibly damaging	Het
Gm13762	G	T	2: 88,973,657	P78Q	probably damaging	Het
Gm14025	T	A	2: 129,038,272	D578V		Het
Gm3127	A	G	14: 4,166,014	N64S	probably damaging	Het
Gm4847	A	C	1: 166,632,680	N412K	probably benign	Het
Gtf3c3	A	T	1: 54,419,641		probably null	Het
Guf1	T	C	5: 69,564,544	S349P	probably damaging	Het
Hvcn1	A	G	5: 122,233,523	Y42C	probably damaging	Het
Insm1	A	G	2: 146,223,107	Y281C	probably damaging	Het
Lrrc71	A	G	3: 87,742,974	I264T	probably damaging	Het
Lrriq1	T	C	10: 103,200,601	N897S	probably damaging	Het
Mtmr6	T	A	14: 60,296,147	F375I	probably damaging	Het
Mtor	G	C	4: 148,452,350	S27T	possibly damaging	Het
Mylk4	T	A	13: 32,708,908	K387N	possibly damaging	Het
Nadk2	T	G	15: 9,092,846	D247E	probably benign	Het
Nfya	T	C	17: 48,392,417	T213A	probably damaging	Het
Nlrp1a	A	G	11: 71,099,528	V1067A	probably benign	Het
Nrbp2	C	T	15: 76,087,408	R206Q	possibly damaging	Het
Oas2	A	G	5: 120,733,228	V722A	probably benign	Het
Pcdhb2	G	T	18: 37,294,947		probably benign	Het
Pdpr	T	A	8: 111,125,685	H561Q	probably damaging	Het
Plcz1	A	G	6: 140,016,127	F233L	probably damaging	Het
Ppp1r3d	A	G	2: 178,413,372	I279T	probably damaging	Het
Psg17	A	G	7: 18,814,491	Y452H	probably damaging	Het
Reg4	T	C	3: 98,233,112		probably null	Het
Rint1	A	G	5: 23,805,479	T229A	probably benign	Het
Robo1	T	G	16: 73,042,978		probably null	Het
Slc22a26	A	C	19: 7,802,587		probably null	Het
Slc22a7	C	T	17: 46,438,230	A54T	probably benign	Het
Slc52a3	C	A	2: 152,004,614	T165N	possibly damaging	Het
Slc7a11	C	T	3: 50,424,037		probably null	Het
Smap2	T	C	4: 121,016,799	N18S	probably benign	Het
Spag6l	T	C	16: 16,777,414	E369G	probably damaging	Het
Tarsl2	T	A	7: 65,676,012	Y445N	probably damaging	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tmprss7	C	T	16: 45,663,274	G579D	probably benign	Het
Tpi1	T	A	6: 124,812,854	K109*	probably null	Het
Ttc25	G	A	11: 100,561,905		probably null	Het
Ttn	T	C	2: 76,798,512	E14466G	possibly damaging	Het
Usp40	A	T	1: 87,962,430	C903*	probably null	Het
Vmn2r104	T	A	17: 20,041,709	L386F	possibly damaging	Het
Vmn2r54	G	A	7: 12,615,703	P651S	probably damaging	Het
Wnk4	C	A	11: 101,262,895	T261K	probably damaging	Het
Wnt2b	T	C	3: 104,947,116	Y342C	probably damaging	Het
Zbtb8b	A	G	4: 129,432,962	Y137H	probably damaging	Het

Other mutations in Cfap65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Cfap65	APN	1	74919183	critical splice donor site	probably null
IGL01526:Cfap65	APN	1	74911078	missense	probably damaging	1.00
IGL01716:Cfap65	APN	1	74927194	missense	probably benign
IGL01780:Cfap65	APN	1	74928348	nonsense	probably null
IGL01993:Cfap65	APN	1	74920543	missense	probably damaging	1.00
IGL02164:Cfap65	APN	1	74928145	missense	possibly damaging	0.87
IGL02350:Cfap65	APN	1	74928348	nonsense	probably null
IGL02357:Cfap65	APN	1	74928348	nonsense	probably null
IGL02576:Cfap65	APN	1	74903458	missense	probably damaging	1.00
IGL02756:Cfap65	APN	1	74905080	missense	probably benign	0.00
IGL02792:Cfap65	APN	1	74927178	missense	probably damaging	1.00
IGL02874:Cfap65	APN	1	74911108	nonsense	probably null
IGL03101:Cfap65	APN	1	74928433	missense	possibly damaging	0.61
IGL03348:Cfap65	APN	1	74927619	missense	probably damaging	1.00
IGL03396:Cfap65	APN	1	74904642	missense	probably damaging	1.00
PIT4131001:Cfap65	UTSW	1	74928342	missense	probably benign	0.05
R0077:Cfap65	UTSW	1	74931918	missense	probably damaging	1.00
R0227:Cfap65	UTSW	1	74931958	nonsense	probably null
R0281:Cfap65	UTSW	1	74927071	missense	probably damaging	1.00
R0312:Cfap65	UTSW	1	74904067	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929301	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929302	missense	probably damaging	1.00
R0347:Cfap65	UTSW	1	74926444	missense	probably damaging	1.00
R0359:Cfap65	UTSW	1	74920601	missense	probably benign	0.00
R0361:Cfap65	UTSW	1	74925440	missense	probably damaging	1.00
R0465:Cfap65	UTSW	1	74916884	missense	possibly damaging	0.92
R0549:Cfap65	UTSW	1	74918444	missense	probably benign	0.01
R0646:Cfap65	UTSW	1	74902169	missense	probably benign	0.09
R0734:Cfap65	UTSW	1	74918887	missense	probably damaging	1.00
R0763:Cfap65	UTSW	1	74904682	missense	probably damaging	0.99
R0990:Cfap65	UTSW	1	74921519	missense	possibly damaging	0.60
R1079:Cfap65	UTSW	1	74902447	missense	probably damaging	0.98
R1079:Cfap65	UTSW	1	74905713	missense	probably damaging	0.99
R1083:Cfap65	UTSW	1	74918504	splice site	probably benign
R1159:Cfap65	UTSW	1	74929340	missense	probably damaging	1.00
R1282:Cfap65	UTSW	1	74925104	missense	probably benign	0.03
R1644:Cfap65	UTSW	1	74917175	missense	probably damaging	1.00
R1796:Cfap65	UTSW	1	74918948	missense	probably damaging	1.00
R1950:Cfap65	UTSW	1	74907660	missense	probably damaging	1.00
R2079:Cfap65	UTSW	1	74917199	missense	probably benign	0.30
R2132:Cfap65	UTSW	1	74907691	missense	probably damaging	1.00
R2136:Cfap65	UTSW	1	74917273	frame shift	probably null
R2219:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2220:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2291:Cfap65	UTSW	1	74926475	missense	probably damaging	1.00
R2417:Cfap65	UTSW	1	74927186	small insertion	probably benign
R3114:Cfap65	UTSW	1	74927132	missense	probably damaging	1.00
R4202:Cfap65	UTSW	1	74920542	missense	probably damaging	1.00
R4214:Cfap65	UTSW	1	74927681	missense	possibly damaging	0.93
R4254:Cfap65	UTSW	1	74903358	missense	probably benign	0.17
R4547:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4548:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4588:Cfap65	UTSW	1	74904056	missense	possibly damaging	0.92
R4657:Cfap65	UTSW	1	74925354	intron	probably benign
R4701:Cfap65	UTSW	1	74918908	missense	probably damaging	0.96
R4755:Cfap65	UTSW	1	74928361	missense	probably damaging	1.00
R4820:Cfap65	UTSW	1	74927632	missense	probably benign	0.06
R4831:Cfap65	UTSW	1	74917295	missense	possibly damaging	0.93
R4866:Cfap65	UTSW	1	74925557	missense	probably damaging	1.00
R4869:Cfap65	UTSW	1	74919261	missense	probably benign	0.00
R4881:Cfap65	UTSW	1	74907613	missense	probably damaging	1.00
R4884:Cfap65	UTSW	1	74903124	missense	possibly damaging	0.47
R4950:Cfap65	UTSW	1	74906336	nonsense	probably null
R5074:Cfap65	UTSW	1	74922978	missense	probably benign	0.04
R5083:Cfap65	UTSW	1	74906441	missense	probably damaging	1.00
R5164:Cfap65	UTSW	1	74926516	missense	probably damaging	1.00
R5268:Cfap65	UTSW	1	74924902	missense	probably benign	0.07
R5333:Cfap65	UTSW	1	74903175	missense	probably benign	0.03
R5417:Cfap65	UTSW	1	74925100	missense	probably damaging	1.00
R5582:Cfap65	UTSW	1	74907518	intron	probably benign
R5669:Cfap65	UTSW	1	74924968	missense	probably damaging	0.99
R6010:Cfap65	UTSW	1	74923031	missense	probably damaging	1.00
R6084:Cfap65	UTSW	1	74920405	missense	probably damaging	1.00
R6112:Cfap65	UTSW	1	74903139	missense	probably benign	0.14
R6425:Cfap65	UTSW	1	74927709	missense	probably benign	0.00
R6677:Cfap65	UTSW	1	74904685	missense	probably damaging	1.00
R6693:Cfap65	UTSW	1	74917286	missense	probably benign	0.00
R6838:Cfap65	UTSW	1	74932021	missense	probably benign	0.06
R6861:Cfap65	UTSW	1	74925115	missense	probably damaging	1.00
R6958:Cfap65	UTSW	1	74931899	missense	possibly damaging	0.58
R7134:Cfap65	UTSW	1	74926633	missense	probably benign	0.01
R7320:Cfap65	UTSW	1	74926604	missense	probably damaging	0.99
R7340:Cfap65	UTSW	1	74921583	missense	probably benign	0.07
R7426:Cfap65	UTSW	1	74920426	missense	possibly damaging	0.92
R7529:Cfap65	UTSW	1	74926610	missense	probably damaging	1.00
R7654:Cfap65	UTSW	1	74933144	missense	probably benign	0.44
R7704:Cfap65	UTSW	1	74928368	missense	probably benign	0.19
R7727:Cfap65	UTSW	1	74926625	missense	probably benign	0.00
R7895:Cfap65	UTSW	1	74933162	missense	probably benign	0.05
R8215:Cfap65	UTSW	1	74910743	missense	probably damaging	1.00
R8344:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8345:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8413:Cfap65	UTSW	1	74917169	nonsense	probably null
R8431:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8432:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8528:Cfap65	UTSW	1	74905937	missense	possibly damaging	0.88
R8809:Cfap65	UTSW	1	74903223	missense	probably benign	0.43
R8996:Cfap65	UTSW	1	74902188	missense	probably benign	0.11
R9020:Cfap65	UTSW	1	74920393	missense	probably damaging	1.00
R9043:Cfap65	UTSW	1	74904688	missense	possibly damaging	0.88
R9127:Cfap65	UTSW	1	74919351	splice site	probably benign
R9187:Cfap65	UTSW	1	74917358	missense	probably benign	0.00
R9210:Cfap65	UTSW	1	74920408	missense	probably benign
R9212:Cfap65	UTSW	1	74920408	missense	probably benign
R9273:Cfap65	UTSW	1	74921610	missense	probably benign	0.00
R9454:Cfap65	UTSW	1	74905051	missense	probably damaging	1.00
R9514:Cfap65	UTSW	1	74906309	critical splice donor site	probably null
R9595:Cfap65	UTSW	1	74907378	missense	probably damaging	1.00
R9721:Cfap65	UTSW	1	74919342	missense	probably benign	0.16
R9742:Cfap65	UTSW	1	74904681	missense	probably benign	0.08
RF009:Cfap65	UTSW	1	74905647	missense	probably damaging	1.00
Z1176:Cfap65	UTSW	1	74910747	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCTTGTGACATCTGCAAGAGG -3'
(R):5'- AGTGTTGCCACCAGAAGCAG -3'

Sequencing Primer
(F):5'- ACATCTGCAAGAGGTTGTCTGTCC -3'
(R):5'- AGCAGGGCTTTCCGTGG -3'

Posted On

2019-10-24