Incidental Mutation 'R7634:Gm14025'
ID 589794
Institutional Source Beutler Lab
Gene Symbol Gm14025
Ensembl Gene ENSMUSG00000079051
Gene Name predicted gene 14025
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R7634 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 129025073-129048172 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 129038272 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 578 (D578V)
Ref Sequence ENSEMBL: ENSMUSP00000123404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145798]
AlphaFold A2AP89
Predicted Effect
SMART Domains Protein: ENSMUSP00000123404
Gene: ENSMUSG00000079051
AA Change: D578V

DomainStartEndE-ValueType
Pfam:Vinculin 14 248 5.8e-18 PFAM
Pfam:Vinculin 281 619 2.1e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat A T 8: 60,516,068 M116L probably benign Het
Adam25 A G 8: 40,754,846 D383G probably benign Het
Adam26b T A 8: 43,520,997 M323L probably benign Het
Adgrf3 T C 5: 30,202,247 H227R probably benign Het
Antxr1 G A 6: 87,137,291 T498I probably benign Het
Arg1 T A 10: 24,915,729 T285S possibly damaging Het
Arhgdig T C 17: 26,199,391 D206G probably damaging Het
Asb10 C A 5: 24,540,877 C17F possibly damaging Het
Atg2b T C 12: 105,652,120 D891G probably damaging Het
Cacna1h A T 17: 25,392,109 S572T possibly damaging Het
Cenpj T C 14: 56,542,800 T985A probably benign Het
Cfap65 G T 1: 74,902,434 N1780K probably damaging Het
Cyp26c1 T C 19: 37,692,999 Y417H probably damaging Het
Dnajb13 G T 7: 100,503,186 Q308K probably benign Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm13762 G T 2: 88,973,657 P78Q probably damaging Het
Gm3127 A G 14: 4,166,014 N64S probably damaging Het
Gm4847 A C 1: 166,632,680 N412K probably benign Het
Gtf3c3 A T 1: 54,419,641 probably null Het
Guf1 T C 5: 69,564,544 S349P probably damaging Het
Hvcn1 A G 5: 122,233,523 Y42C probably damaging Het
Insm1 A G 2: 146,223,107 Y281C probably damaging Het
Lrrc71 A G 3: 87,742,974 I264T probably damaging Het
Lrriq1 T C 10: 103,200,601 N897S probably damaging Het
Mtmr6 T A 14: 60,296,147 F375I probably damaging Het
Mtor G C 4: 148,452,350 S27T possibly damaging Het
Mylk4 T A 13: 32,708,908 K387N possibly damaging Het
Nadk2 T G 15: 9,092,846 D247E probably benign Het
Nfya T C 17: 48,392,417 T213A probably damaging Het
Nlrp1a A G 11: 71,099,528 V1067A probably benign Het
Nrbp2 C T 15: 76,087,408 R206Q possibly damaging Het
Oas2 A G 5: 120,733,228 V722A probably benign Het
Pcdhb2 G T 18: 37,294,947 probably benign Het
Pdpr T A 8: 111,125,685 H561Q probably damaging Het
Plcz1 A G 6: 140,016,127 F233L probably damaging Het
Ppp1r3d A G 2: 178,413,372 I279T probably damaging Het
Psg17 A G 7: 18,814,491 Y452H probably damaging Het
Reg4 T C 3: 98,233,112 probably null Het
Rint1 A G 5: 23,805,479 T229A probably benign Het
Robo1 T G 16: 73,042,978 probably null Het
Slc22a26 A C 19: 7,802,587 probably null Het
Slc22a7 C T 17: 46,438,230 A54T probably benign Het
Slc52a3 C A 2: 152,004,614 T165N possibly damaging Het
Slc7a11 C T 3: 50,424,037 probably null Het
Smap2 T C 4: 121,016,799 N18S probably benign Het
Spag6l T C 16: 16,777,414 E369G probably damaging Het
Tarsl2 T A 7: 65,676,012 Y445N probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmprss7 C T 16: 45,663,274 G579D probably benign Het
Tpi1 T A 6: 124,812,854 K109* probably null Het
Ttc25 G A 11: 100,561,905 probably null Het
Ttn T C 2: 76,798,512 E14466G possibly damaging Het
Usp40 A T 1: 87,962,430 C903* probably null Het
Vmn2r104 T A 17: 20,041,709 L386F possibly damaging Het
Vmn2r54 G A 7: 12,615,703 P651S probably damaging Het
Wnk4 C A 11: 101,262,895 T261K probably damaging Het
Wnt2b T C 3: 104,947,116 Y342C probably damaging Het
Zbtb8b A G 4: 129,432,962 Y137H probably damaging Het
Other mutations in Gm14025
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Gm14025 APN 2 129038702 missense probably benign 0.01
IGL02423:Gm14025 APN 2 129048048 missense probably benign 0.03
IGL02730:Gm14025 APN 2 129038726 missense possibly damaging 0.57
PIT4677001:Gm14025 UTSW 2 129038716 missense
R0019:Gm14025 UTSW 2 129039026 missense probably benign 0.26
R3946:Gm14025 UTSW 2 129039601 missense probably damaging 1.00
R4666:Gm14025 UTSW 2 129038230 missense probably benign 0.02
R4819:Gm14025 UTSW 2 129040801 missense probably damaging 0.96
R5634:Gm14025 UTSW 2 129039486 missense probably benign
R6019:Gm14025 UTSW 2 129037690 missense probably benign
R6241:Gm14025 UTSW 2 129037381 missense possibly damaging 0.87
R6285:Gm14025 UTSW 2 129037799 missense possibly damaging 0.82
R6377:Gm14025 UTSW 2 129036811 missense unknown
R6464:Gm14025 UTSW 2 129039545 missense possibly damaging 0.85
R6724:Gm14025 UTSW 2 129038056 missense probably benign 0.23
R7050:Gm14025 UTSW 2 129027971 splice site probably null
R7130:Gm14025 UTSW 2 129039181 missense
R7199:Gm14025 UTSW 2 129038318 missense
R7324:Gm14025 UTSW 2 129037852 missense unknown
R7355:Gm14025 UTSW 2 129037229 missense unknown
R7407:Gm14025 UTSW 2 129038809 missense
R7688:Gm14025 UTSW 2 129039044 nonsense probably null
R7889:Gm14025 UTSW 2 129036994 missense unknown
R7894:Gm14025 UTSW 2 129037129 missense unknown
R8242:Gm14025 UTSW 2 129039393 nonsense probably null
R8373:Gm14025 UTSW 2 129038171 missense
R8927:Gm14025 UTSW 2 129040869 missense
R8928:Gm14025 UTSW 2 129040869 missense
R9231:Gm14025 UTSW 2 129037420 missense unknown
R9504:Gm14025 UTSW 2 129039269 missense
R9505:Gm14025 UTSW 2 129036918 missense unknown
R9608:Gm14025 UTSW 2 129036630 nonsense probably null
R9682:Gm14025 UTSW 2 129033609 missense unknown
R9760:Gm14025 UTSW 2 129038579 missense
RF002:Gm14025 UTSW 2 129038794 missense
X0066:Gm14025 UTSW 2 129039067 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TTCCATAACCCAGGTACCCG -3'
(R):5'- AGATCTGTGGCATTCTTACGC -3'

Sequencing Primer
(F):5'- ACCCGCTGGTACTTTATTTCAGAAG -3'
(R):5'- ATTCTTACGCGGAAGAGCC -3'
Posted On 2019-10-24