Mutagenetix > Incidental Mutation

Incidental Mutation 'R7634:Rint1'

589804

Institutional Source

Beutler Lab

Gene Symbol

Rint1

Ensembl Gene

ENSMUSG00000028999

Gene Name

RAD50 interactor 1

Synonyms

2810450M21Rik, 1500019C06Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7634 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23787711-23820369 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23805479 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 229 (T229A)

Ref Sequence

ENSEMBL: ENSMUSP00000030852 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030852] [ENSMUST00000115113]

AlphaFold

Q8BZ36

Predicted Effect

probably benign
Transcript: ENSMUST00000030852
AA Change: T229A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000030852
Gene: ENSMUSG00000028999
AA Change: T229A

Domain	Start	End	E-Value	Type
Pfam:RINT1_TIP1	304	784	2.3e-135	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115113

SMART Domains

Protein: ENSMUSP00000110766
Gene: ENSMUSG00000028999

Domain	Start	End	E-Value	Type
Pfam:RINT1_TIP1	246	727	1.2e-161	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein first identified for its ability to interact with the RAD50 double strand break repair protein, with the resulting interaction implicated in the regulation of cell cycle progression and telomere length. The encoded protein may also play a role in trafficking of cellular cargo from the endosome to the trans-Golgi network. Mutations in this gene may be associated with breast cancer in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a mutant allele exhibit early embryonic lethality. Mice heterozygous for a mutant allele exhibit premature death with a life span of 24 months and increased multiple tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadat	A	T	8: 60,516,068	M116L	probably benign	Het
Adam25	A	G	8: 40,754,846	D383G	probably benign	Het
Adam26b	T	A	8: 43,520,997	M323L	probably benign	Het
Adgrf3	T	C	5: 30,202,247	H227R	probably benign	Het
Antxr1	G	A	6: 87,137,291	T498I	probably benign	Het
Arg1	T	A	10: 24,915,729	T285S	possibly damaging	Het
Arhgdig	T	C	17: 26,199,391	D206G	probably damaging	Het
Asb10	C	A	5: 24,540,877	C17F	possibly damaging	Het
Atg2b	T	C	12: 105,652,120	D891G	probably damaging	Het
Cacna1h	A	T	17: 25,392,109	S572T	possibly damaging	Het
Cenpj	T	C	14: 56,542,800	T985A	probably benign	Het
Cfap65	G	T	1: 74,902,434	N1780K	probably damaging	Het
Cyp26c1	T	C	19: 37,692,999	Y417H	probably damaging	Het
Dnajb13	G	T	7: 100,503,186	Q308K	probably benign	Het
Fam107b	T	C	2: 3,770,740	S3P	possibly damaging	Het
Gm13762	G	T	2: 88,973,657	P78Q	probably damaging	Het
Gm14025	T	A	2: 129,038,272	D578V		Het
Gm3127	A	G	14: 4,166,014	N64S	probably damaging	Het
Gm4847	A	C	1: 166,632,680	N412K	probably benign	Het
Gtf3c3	A	T	1: 54,419,641		probably null	Het
Guf1	T	C	5: 69,564,544	S349P	probably damaging	Het
Hvcn1	A	G	5: 122,233,523	Y42C	probably damaging	Het
Insm1	A	G	2: 146,223,107	Y281C	probably damaging	Het
Lrrc71	A	G	3: 87,742,974	I264T	probably damaging	Het
Lrriq1	T	C	10: 103,200,601	N897S	probably damaging	Het
Mtmr6	T	A	14: 60,296,147	F375I	probably damaging	Het
Mtor	G	C	4: 148,452,350	S27T	possibly damaging	Het
Mylk4	T	A	13: 32,708,908	K387N	possibly damaging	Het
Nadk2	T	G	15: 9,092,846	D247E	probably benign	Het
Nfya	T	C	17: 48,392,417	T213A	probably damaging	Het
Nlrp1a	A	G	11: 71,099,528	V1067A	probably benign	Het
Nrbp2	C	T	15: 76,087,408	R206Q	possibly damaging	Het
Oas2	A	G	5: 120,733,228	V722A	probably benign	Het
Pcdhb2	G	T	18: 37,294,947		probably benign	Het
Pdpr	T	A	8: 111,125,685	H561Q	probably damaging	Het
Plcz1	A	G	6: 140,016,127	F233L	probably damaging	Het
Ppp1r3d	A	G	2: 178,413,372	I279T	probably damaging	Het
Psg17	A	G	7: 18,814,491	Y452H	probably damaging	Het
Reg4	T	C	3: 98,233,112		probably null	Het
Robo1	T	G	16: 73,042,978		probably null	Het
Slc22a26	A	C	19: 7,802,587		probably null	Het
Slc22a7	C	T	17: 46,438,230	A54T	probably benign	Het
Slc52a3	C	A	2: 152,004,614	T165N	possibly damaging	Het
Slc7a11	C	T	3: 50,424,037		probably null	Het
Smap2	T	C	4: 121,016,799	N18S	probably benign	Het
Spag6l	T	C	16: 16,777,414	E369G	probably damaging	Het
Tarsl2	T	A	7: 65,676,012	Y445N	probably damaging	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tmprss7	C	T	16: 45,663,274	G579D	probably benign	Het
Tpi1	T	A	6: 124,812,854	K109*	probably null	Het
Ttc25	G	A	11: 100,561,905		probably null	Het
Ttn	T	C	2: 76,798,512	E14466G	possibly damaging	Het
Usp40	A	T	1: 87,962,430	C903*	probably null	Het
Vmn2r104	T	A	17: 20,041,709	L386F	possibly damaging	Het
Vmn2r54	G	A	7: 12,615,703	P651S	probably damaging	Het
Wnk4	C	A	11: 101,262,895	T261K	probably damaging	Het
Wnt2b	T	C	3: 104,947,116	Y342C	probably damaging	Het
Zbtb8b	A	G	4: 129,432,962	Y137H	probably damaging	Het

Other mutations in Rint1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Rint1	APN	5	23794431	missense	probably benign	0.00
IGL00596:Rint1	APN	5	23811865	missense	probably damaging	0.99
IGL01685:Rint1	APN	5	23787834	unclassified	probably benign
IGL02428:Rint1	APN	5	23794452	nonsense	probably null
IGL03007:Rint1	APN	5	23815701	missense	probably benign	0.00
IGL03280:Rint1	APN	5	23817078	missense	probably damaging	1.00
breakage	UTSW	5	23800722	missense	probably damaging	0.99
IGL02799:Rint1	UTSW	5	23819480	missense	possibly damaging	0.93
R0062:Rint1	UTSW	5	23787828	unclassified	probably benign
R0243:Rint1	UTSW	5	23816932	splice site	probably benign
R1102:Rint1	UTSW	5	23805567	splice site	probably benign
R1552:Rint1	UTSW	5	23800658	missense	probably benign	0.00
R1729:Rint1	UTSW	5	23809843	missense	probably benign	0.00
R1784:Rint1	UTSW	5	23809843	missense	probably benign	0.00
R2070:Rint1	UTSW	5	23810929	missense	possibly damaging	0.94
R2920:Rint1	UTSW	5	23805402	missense	probably benign	0.00
R3114:Rint1	UTSW	5	23819420	missense	probably benign	0.27
R4398:Rint1	UTSW	5	23794447	missense	possibly damaging	0.55
R4756:Rint1	UTSW	5	23809793	missense	probably damaging	1.00
R5246:Rint1	UTSW	5	23800811	missense	probably damaging	0.99
R5452:Rint1	UTSW	5	23794365	missense	probably benign	0.01
R5566:Rint1	UTSW	5	23810953	missense	probably damaging	1.00
R5709:Rint1	UTSW	5	23815833	missense	probably damaging	0.98
R6524:Rint1	UTSW	5	23815739	missense	probably benign	0.00
R7346:Rint1	UTSW	5	23815653	missense	possibly damaging	0.82
R7549:Rint1	UTSW	5	23815704	missense	probably benign
R7647:Rint1	UTSW	5	23800802	missense	probably damaging	1.00
R7885:Rint1	UTSW	5	23805644	missense	probably benign
R7895:Rint1	UTSW	5	23800722	missense	probably damaging	0.99
R8347:Rint1	UTSW	5	23811772	missense	probably damaging	1.00
R8791:Rint1	UTSW	5	23800596	missense	probably damaging	0.99
R8900:Rint1	UTSW	5	23811884	missense	possibly damaging	0.77
R8916:Rint1	UTSW	5	23787828	unclassified	probably benign
R8973:Rint1	UTSW	5	23811730	missense	probably benign	0.00
R9245:Rint1	UTSW	5	23805413	missense	probably benign
R9339:Rint1	UTSW	5	23788357	makesense	probably null
R9630:Rint1	UTSW	5	23815812	missense	possibly damaging	0.82
R9718:Rint1	UTSW	5	23800723	missense	possibly damaging	0.53
Z1088:Rint1	UTSW	5	23805314	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCCGCAGTGATAACATTCAGC -3'
(R):5'- AGCTGACAAAACAGTGTGTCC -3'

Sequencing Primer
(F):5'- GCAGTGATAACATTCAGCAGTACCTG -3'
(R):5'- AACAGTGTGTCCAGGCTACTGTAC -3'

Posted On

2019-10-24