Incidental Mutation 'R7634:Adam25'
ID589817
Institutional Source Beutler Lab
Gene Symbol Adam25
Ensembl Gene ENSMUSG00000071937
Gene Namea disintegrin and metallopeptidase domain 25 (testase 2)
Synonymstestase 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7634 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location40752208-40756176 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40754846 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 383 (D383G)
Ref Sequence ENSEMBL: ENSMUSP00000094420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096663]
Predicted Effect probably benign
Transcript: ENSMUST00000096663
AA Change: D383G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000094420
Gene: ENSMUSG00000071937
AA Change: D383G

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 53 179 3.4e-21 PFAM
Pfam:Reprolysin_5 220 398 1.6e-16 PFAM
Pfam:Reprolysin_4 220 407 2.5e-13 PFAM
Pfam:Reprolysin 221 410 5.6e-46 PFAM
Pfam:Reprolysin_2 222 399 9.7e-14 PFAM
Pfam:Reprolysin_3 246 366 1e-18 PFAM
DISIN 428 503 3.33e-39 SMART
ACR 504 640 8.95e-74 SMART
transmembrane domain 706 728 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. This gene is located adjacent to other ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat A T 8: 60,516,068 M116L probably benign Het
Adam26b T A 8: 43,520,997 M323L probably benign Het
Adgrf3 T C 5: 30,202,247 H227R probably benign Het
Antxr1 G A 6: 87,137,291 T498I probably benign Het
Arg1 T A 10: 24,915,729 T285S possibly damaging Het
Arhgdig T C 17: 26,199,391 D206G probably damaging Het
Asb10 C A 5: 24,540,877 C17F possibly damaging Het
Atg2b T C 12: 105,652,120 D891G probably damaging Het
Cacna1h A T 17: 25,392,109 S572T possibly damaging Het
Cenpj T C 14: 56,542,800 T985A probably benign Het
Cfap65 G T 1: 74,902,434 N1780K probably damaging Het
Cyp26c1 T C 19: 37,692,999 Y417H probably damaging Het
Dnajb13 G T 7: 100,503,186 Q308K probably benign Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm13762 G T 2: 88,973,657 P78Q probably damaging Het
Gm14025 T A 2: 129,038,272 D578V Het
Gm3127 A G 14: 4,166,014 N64S probably damaging Het
Gm4847 A C 1: 166,632,680 N412K probably benign Het
Guf1 T C 5: 69,564,544 S349P probably damaging Het
Hvcn1 A G 5: 122,233,523 Y42C probably damaging Het
Insm1 A G 2: 146,223,107 Y281C probably damaging Het
Lrrc71 A G 3: 87,742,974 I264T probably damaging Het
Lrriq1 T C 10: 103,200,601 N897S probably damaging Het
Mtmr6 T A 14: 60,296,147 F375I probably damaging Het
Mtor G C 4: 148,452,350 S27T possibly damaging Het
Mylk4 T A 13: 32,708,908 K387N possibly damaging Het
Nadk2 T G 15: 9,092,846 D247E probably benign Het
Nfya T C 17: 48,392,417 T213A probably damaging Het
Nlrp1a A G 11: 71,099,528 V1067A probably benign Het
Nrbp2 C T 15: 76,087,408 R206Q possibly damaging Het
Oas2 A G 5: 120,733,228 V722A probably benign Het
Pcdhb2 G T 18: 37,294,947 probably benign Het
Pdpr T A 8: 111,125,685 H561Q probably damaging Het
Plcz1 A G 6: 140,016,127 F233L probably damaging Het
Ppp1r3d A G 2: 178,413,372 I279T probably damaging Het
Psg17 A G 7: 18,814,491 Y452H probably damaging Het
Reg4 T C 3: 98,233,112 probably null Het
Rint1 A G 5: 23,805,479 T229A probably benign Het
Slc22a7 C T 17: 46,438,230 A54T probably benign Het
Slc52a3 C A 2: 152,004,614 T165N possibly damaging Het
Smap2 T C 4: 121,016,799 N18S probably benign Het
Spag6l T C 16: 16,777,414 E369G probably damaging Het
Tarsl2 T A 7: 65,676,012 Y445N probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmprss7 C T 16: 45,663,274 G579D probably benign Het
Tpi1 T A 6: 124,812,854 K109* probably null Het
Ttc25 G A 11: 100,561,905 probably null Het
Ttn T C 2: 76,798,512 E14466G possibly damaging Het
Usp40 A T 1: 87,962,430 C903* probably null Het
Vmn2r104 T A 17: 20,041,709 L386F possibly damaging Het
Vmn2r54 G A 7: 12,615,703 P651S probably damaging Het
Wnk4 C A 11: 101,262,895 T261K probably damaging Het
Wnt2b T C 3: 104,947,116 Y342C probably damaging Het
Zbtb8b A G 4: 129,432,962 Y137H probably damaging Het
Other mutations in Adam25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Adam25 APN 8 40754921 missense probably benign
IGL01977:Adam25 APN 8 40755097 missense probably benign 0.00
IGL02098:Adam25 APN 8 40755643 missense probably benign 0.12
IGL02233:Adam25 APN 8 40755386 missense probably damaging 1.00
IGL02458:Adam25 APN 8 40753807 missense probably benign 0.01
IGL02527:Adam25 APN 8 40753748 missense possibly damaging 0.78
IGL02632:Adam25 APN 8 40755200 missense possibly damaging 0.90
IGL02995:Adam25 APN 8 40753723 missense probably benign 0.00
H8786:Adam25 UTSW 8 40754224 missense probably benign 0.00
R0062:Adam25 UTSW 8 40754792 missense probably damaging 1.00
R0062:Adam25 UTSW 8 40754792 missense probably damaging 1.00
R0189:Adam25 UTSW 8 40755430 missense probably damaging 1.00
R0505:Adam25 UTSW 8 40755224 missense probably damaging 1.00
R0532:Adam25 UTSW 8 40755950 missense probably benign 0.00
R0699:Adam25 UTSW 8 40755974 missense probably benign
R0972:Adam25 UTSW 8 40755131 missense probably damaging 1.00
R1053:Adam25 UTSW 8 40754731 missense probably benign 0.30
R1079:Adam25 UTSW 8 40755476 missense possibly damaging 0.87
R1872:Adam25 UTSW 8 40755226 nonsense probably null
R1933:Adam25 UTSW 8 40754885 missense probably benign 0.01
R1934:Adam25 UTSW 8 40754885 missense probably benign 0.01
R4061:Adam25 UTSW 8 40753782 missense possibly damaging 0.67
R4702:Adam25 UTSW 8 40754126 missense probably damaging 1.00
R4703:Adam25 UTSW 8 40754126 missense probably damaging 1.00
R4705:Adam25 UTSW 8 40754126 missense probably damaging 1.00
R4859:Adam25 UTSW 8 40754543 missense probably benign 0.01
R5015:Adam25 UTSW 8 40754634 missense probably benign 0.22
R5249:Adam25 UTSW 8 40755954 missense probably benign
R5628:Adam25 UTSW 8 40755710 missense probably benign 0.00
R5791:Adam25 UTSW 8 40754220 missense probably benign
R6439:Adam25 UTSW 8 40754590 missense possibly damaging 0.92
R6693:Adam25 UTSW 8 40754531 missense probably damaging 1.00
R7041:Adam25 UTSW 8 40754084 missense probably benign 0.04
R7101:Adam25 UTSW 8 40755401 missense probably benign 0.00
R7531:Adam25 UTSW 8 40753877 missense probably damaging 0.99
R7600:Adam25 UTSW 8 40755817 missense probably benign 0.01
RF006:Adam25 UTSW 8 40755797 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGTCTGTGTGCCATCTC -3'
(R):5'- TGGCAATATAAGCAGCAAAGCC -3'

Sequencing Primer
(F):5'- TGCCATCTCATAACTGTGGAG -3'
(R):5'- TTACAGCATGGATCATCTGCACAG -3'
Posted On2019-10-24