Incidental Mutation 'R7634:Aadat'
ID589819
Institutional Source Beutler Lab
Gene Symbol Aadat
Ensembl Gene ENSMUSG00000057228
Gene Nameaminoadipate aminotransferase
SynonymsKATII, Kat2, mKat-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7634 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location60505932-60545677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60516068 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 116 (M116L)
Ref Sequence ENSEMBL: ENSMUSP00000148060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079472] [ENSMUST00000209338]
Predicted Effect probably benign
Transcript: ENSMUST00000079472
AA Change: M109L

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000078436
Gene: ENSMUSG00000057228
AA Change: M109L

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 64 417 2.6e-22 PFAM
Pfam:Aminotran_MocR 124 424 7.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209338
AA Change: M116L

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to mouse and rat kynurenine aminotransferase II. The rat protein is a homodimer with two transaminase activities. One activity is the transamination of alpha-aminoadipic acid, a final step in the saccaropine pathway which is the major pathway for L-lysine catabolism. The other activity involves the transamination of kynurenine to produce kynurenine acid, the precursor of kynurenic acid which has neuroprotective properties. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous null mice are viable and display earlier eye opening and development of air righting and open field crossing responses, and transient hyperactivity and neuronal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 40,754,846 D383G probably benign Het
Adam26b T A 8: 43,520,997 M323L probably benign Het
Adgrf3 T C 5: 30,202,247 H227R probably benign Het
Antxr1 G A 6: 87,137,291 T498I probably benign Het
Arg1 T A 10: 24,915,729 T285S possibly damaging Het
Arhgdig T C 17: 26,199,391 D206G probably damaging Het
Asb10 C A 5: 24,540,877 C17F possibly damaging Het
Atg2b T C 12: 105,652,120 D891G probably damaging Het
Cacna1h A T 17: 25,392,109 S572T possibly damaging Het
Cenpj T C 14: 56,542,800 T985A probably benign Het
Cfap65 G T 1: 74,902,434 N1780K probably damaging Het
Cyp26c1 T C 19: 37,692,999 Y417H probably damaging Het
Dnajb13 G T 7: 100,503,186 Q308K probably benign Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm13762 G T 2: 88,973,657 P78Q probably damaging Het
Gm14025 T A 2: 129,038,272 D578V Het
Gm3127 A G 14: 4,166,014 N64S probably damaging Het
Gm4847 A C 1: 166,632,680 N412K probably benign Het
Gtf3c3 A T 1: 54,419,641 probably null Het
Guf1 T C 5: 69,564,544 S349P probably damaging Het
Hvcn1 A G 5: 122,233,523 Y42C probably damaging Het
Insm1 A G 2: 146,223,107 Y281C probably damaging Het
Lrrc71 A G 3: 87,742,974 I264T probably damaging Het
Lrriq1 T C 10: 103,200,601 N897S probably damaging Het
Mtmr6 T A 14: 60,296,147 F375I probably damaging Het
Mtor G C 4: 148,452,350 S27T possibly damaging Het
Mylk4 T A 13: 32,708,908 K387N possibly damaging Het
Nadk2 T G 15: 9,092,846 D247E probably benign Het
Nfya T C 17: 48,392,417 T213A probably damaging Het
Nlrp1a A G 11: 71,099,528 V1067A probably benign Het
Nrbp2 C T 15: 76,087,408 R206Q possibly damaging Het
Oas2 A G 5: 120,733,228 V722A probably benign Het
Pcdhb2 G T 18: 37,294,947 probably benign Het
Pdpr T A 8: 111,125,685 H561Q probably damaging Het
Plcz1 A G 6: 140,016,127 F233L probably damaging Het
Ppp1r3d A G 2: 178,413,372 I279T probably damaging Het
Psg17 A G 7: 18,814,491 Y452H probably damaging Het
Reg4 T C 3: 98,233,112 probably null Het
Rint1 A G 5: 23,805,479 T229A probably benign Het
Robo1 T G 16: 73,042,978 probably null Het
Slc22a26 A C 19: 7,802,587 probably null Het
Slc22a7 C T 17: 46,438,230 A54T probably benign Het
Slc52a3 C A 2: 152,004,614 T165N possibly damaging Het
Slc7a11 C T 3: 50,424,037 probably null Het
Smap2 T C 4: 121,016,799 N18S probably benign Het
Spag6l T C 16: 16,777,414 E369G probably damaging Het
Tarsl2 T A 7: 65,676,012 Y445N probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmprss7 C T 16: 45,663,274 G579D probably benign Het
Tpi1 T A 6: 124,812,854 K109* probably null Het
Ttc25 G A 11: 100,561,905 probably null Het
Ttn T C 2: 76,798,512 E14466G possibly damaging Het
Usp40 A T 1: 87,962,430 C903* probably null Het
Vmn2r104 T A 17: 20,041,709 L386F possibly damaging Het
Vmn2r54 G A 7: 12,615,703 P651S probably damaging Het
Wnk4 C A 11: 101,262,895 T261K probably damaging Het
Wnt2b T C 3: 104,947,116 Y342C probably damaging Het
Zbtb8b A G 4: 129,432,962 Y137H probably damaging Het
Other mutations in Aadat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Aadat APN 8 60535758 missense probably benign 0.11
IGL01123:Aadat APN 8 60526614 missense probably benign 0.14
IGL01524:Aadat APN 8 60516072 missense probably damaging 0.97
IGL01767:Aadat APN 8 60507092 missense probably damaging 0.96
IGL02824:Aadat APN 8 60516022 missense probably benign 0.01
IGL03150:Aadat APN 8 60543562 missense probably damaging 0.97
IGL03356:Aadat APN 8 60531691 missense probably damaging 1.00
R0015:Aadat UTSW 8 60534571 splice site probably benign
R0294:Aadat UTSW 8 60534608 missense possibly damaging 0.77
R0533:Aadat UTSW 8 60531763 splice site probably benign
R0631:Aadat UTSW 8 60529445 splice site probably benign
R1585:Aadat UTSW 8 60526680 missense possibly damaging 0.67
R1728:Aadat UTSW 8 60526712 missense probably damaging 1.00
R1729:Aadat UTSW 8 60526712 missense probably damaging 1.00
R2051:Aadat UTSW 8 60507139 missense probably benign 0.00
R2362:Aadat UTSW 8 60532298 splice site probably benign
R3971:Aadat UTSW 8 60518581 missense probably damaging 1.00
R4126:Aadat UTSW 8 60531669 missense probably benign 0.00
R4736:Aadat UTSW 8 60540106 missense probably benign 0.30
R4739:Aadat UTSW 8 60540106 missense probably benign 0.30
R4750:Aadat UTSW 8 60526600 missense probably benign 0.10
R4874:Aadat UTSW 8 60516113 critical splice donor site probably null
R4884:Aadat UTSW 8 60526629 missense probably damaging 1.00
R5233:Aadat UTSW 8 60526622 missense probably benign 0.01
R5367:Aadat UTSW 8 60526596 missense probably damaging 1.00
R6920:Aadat UTSW 8 60529433 missense probably damaging 0.97
R7064:Aadat UTSW 8 60531712 missense probably damaging 1.00
R7194:Aadat UTSW 8 60526622 missense probably benign 0.01
R7316:Aadat UTSW 8 60526634 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGCTGAAAGGCATTTGAGAG -3'
(R):5'- GAGCATGTGTACCTGCCTTGTG -3'

Sequencing Primer
(F):5'- GAGCCACTATTTCTTCTCTG -3'
(R):5'- ACCTGCCTTGTGTGTGC -3'
Posted On2019-10-24