Incidental Mutation 'R7634:Vmn2r104'
ID589836
Institutional Source Beutler Lab
Gene Symbol Vmn2r104
Ensembl Gene ENSMUSG00000090315
Gene Namevomeronasal 2, receptor 104
SynonymsV2r7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R7634 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location20029425-20048205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20041709 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 386 (L386F)
Ref Sequence ENSEMBL: ENSMUSP00000129895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168050]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168050
AA Change: L386F

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: L386F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 85 457 4e-38 PFAM
Pfam:NCD3G 512 565 2.1e-20 PFAM
Pfam:7tm_3 598 833 1.7e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat A T 8: 60,516,068 M116L probably benign Het
Adam25 A G 8: 40,754,846 D383G probably benign Het
Adam26b T A 8: 43,520,997 M323L probably benign Het
Adgrf3 T C 5: 30,202,247 H227R probably benign Het
Antxr1 G A 6: 87,137,291 T498I probably benign Het
Arg1 T A 10: 24,915,729 T285S possibly damaging Het
Arhgdig T C 17: 26,199,391 D206G probably damaging Het
Asb10 C A 5: 24,540,877 C17F possibly damaging Het
Atg2b T C 12: 105,652,120 D891G probably damaging Het
Cacna1h A T 17: 25,392,109 S572T possibly damaging Het
Cenpj T C 14: 56,542,800 T985A probably benign Het
Cfap65 G T 1: 74,902,434 N1780K probably damaging Het
Cyp26c1 T C 19: 37,692,999 Y417H probably damaging Het
Dnajb13 G T 7: 100,503,186 Q308K probably benign Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm13762 G T 2: 88,973,657 P78Q probably damaging Het
Gm14025 T A 2: 129,038,272 D578V Het
Gm3127 A G 14: 4,166,014 N64S probably damaging Het
Gm4847 A C 1: 166,632,680 N412K probably benign Het
Gtf3c3 A T 1: 54,419,641 probably null Het
Guf1 T C 5: 69,564,544 S349P probably damaging Het
Hvcn1 A G 5: 122,233,523 Y42C probably damaging Het
Insm1 A G 2: 146,223,107 Y281C probably damaging Het
Lrrc71 A G 3: 87,742,974 I264T probably damaging Het
Lrriq1 T C 10: 103,200,601 N897S probably damaging Het
Mtmr6 T A 14: 60,296,147 F375I probably damaging Het
Mtor G C 4: 148,452,350 S27T possibly damaging Het
Mylk4 T A 13: 32,708,908 K387N possibly damaging Het
Nadk2 T G 15: 9,092,846 D247E probably benign Het
Nfya T C 17: 48,392,417 T213A probably damaging Het
Nlrp1a A G 11: 71,099,528 V1067A probably benign Het
Nrbp2 C T 15: 76,087,408 R206Q possibly damaging Het
Oas2 A G 5: 120,733,228 V722A probably benign Het
Pcdhb2 G T 18: 37,294,947 probably benign Het
Pdpr T A 8: 111,125,685 H561Q probably damaging Het
Plcz1 A G 6: 140,016,127 F233L probably damaging Het
Ppp1r3d A G 2: 178,413,372 I279T probably damaging Het
Psg17 A G 7: 18,814,491 Y452H probably damaging Het
Reg4 T C 3: 98,233,112 probably null Het
Rint1 A G 5: 23,805,479 T229A probably benign Het
Robo1 T G 16: 73,042,978 probably null Het
Slc22a26 A C 19: 7,802,587 probably null Het
Slc22a7 C T 17: 46,438,230 A54T probably benign Het
Slc52a3 C A 2: 152,004,614 T165N possibly damaging Het
Slc7a11 C T 3: 50,424,037 probably null Het
Smap2 T C 4: 121,016,799 N18S probably benign Het
Spag6l T C 16: 16,777,414 E369G probably damaging Het
Tarsl2 T A 7: 65,676,012 Y445N probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmprss7 C T 16: 45,663,274 G579D probably benign Het
Tpi1 T A 6: 124,812,854 K109* probably null Het
Ttc25 G A 11: 100,561,905 probably null Het
Ttn T C 2: 76,798,512 E14466G possibly damaging Het
Usp40 A T 1: 87,962,430 C903* probably null Het
Vmn2r54 G A 7: 12,615,703 P651S probably damaging Het
Wnk4 C A 11: 101,262,895 T261K probably damaging Het
Wnt2b T C 3: 104,947,116 Y342C probably damaging Het
Zbtb8b A G 4: 129,432,962 Y137H probably damaging Het
Other mutations in Vmn2r104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn2r104 APN 17 20038239 missense probably damaging 0.98
IGL01098:Vmn2r104 APN 17 20048096 missense probably benign 0.27
IGL01333:Vmn2r104 APN 17 20042793 missense probably benign 0.17
IGL01527:Vmn2r104 APN 17 20042896 missense possibly damaging 0.82
IGL01773:Vmn2r104 APN 17 20040668 missense probably benign 0.10
IGL01939:Vmn2r104 APN 17 20029925 missense probably damaging 0.99
IGL02121:Vmn2r104 APN 17 20041794 nonsense probably null
IGL02305:Vmn2r104 APN 17 20042856 missense probably benign 0.09
IGL02374:Vmn2r104 APN 17 20042786 missense probably benign 0.34
IGL03260:Vmn2r104 APN 17 20042821 missense probably benign 0.05
IGL03366:Vmn2r104 APN 17 20029604 missense probably damaging 1.00
R0091:Vmn2r104 UTSW 17 20041813 missense possibly damaging 0.79
R0125:Vmn2r104 UTSW 17 20029807 missense probably damaging 0.98
R0257:Vmn2r104 UTSW 17 20029627 missense probably damaging 1.00
R0381:Vmn2r104 UTSW 17 20048002 nonsense probably null
R0709:Vmn2r104 UTSW 17 20042904 missense probably damaging 1.00
R0786:Vmn2r104 UTSW 17 20042725 missense probably benign
R1575:Vmn2r104 UTSW 17 20042215 missense probably damaging 1.00
R1827:Vmn2r104 UTSW 17 20042235 missense probably damaging 0.97
R1932:Vmn2r104 UTSW 17 20040769 missense probably damaging 1.00
R1956:Vmn2r104 UTSW 17 20042051 missense probably damaging 0.98
R2203:Vmn2r104 UTSW 17 20029821 missense probably benign 0.05
R2205:Vmn2r104 UTSW 17 20029821 missense probably benign 0.05
R2859:Vmn2r104 UTSW 17 20048193 missense possibly damaging 0.82
R3701:Vmn2r104 UTSW 17 20029556 missense probably damaging 1.00
R3834:Vmn2r104 UTSW 17 20029921 missense probably benign 0.02
R4151:Vmn2r104 UTSW 17 20029885 missense probably damaging 1.00
R4470:Vmn2r104 UTSW 17 20042241 missense probably damaging 1.00
R4625:Vmn2r104 UTSW 17 20048181 missense probably benign 0.00
R4754:Vmn2r104 UTSW 17 20040768 nonsense probably null
R4911:Vmn2r104 UTSW 17 20030026 missense probably benign 0.00
R5270:Vmn2r104 UTSW 17 20038266 missense probably damaging 1.00
R5279:Vmn2r104 UTSW 17 20041884 missense probably benign 0.07
R5311:Vmn2r104 UTSW 17 20029901 missense probably damaging 1.00
R5370:Vmn2r104 UTSW 17 20030188 missense probably damaging 0.97
R5461:Vmn2r104 UTSW 17 20030081 missense probably damaging 1.00
R5683:Vmn2r104 UTSW 17 20040719 nonsense probably null
R5795:Vmn2r104 UTSW 17 20030110 missense probably benign 0.02
R5795:Vmn2r104 UTSW 17 20030282 missense possibly damaging 0.89
R5970:Vmn2r104 UTSW 17 20029471 missense probably benign 0.01
R5983:Vmn2r104 UTSW 17 20041708 missense probably damaging 1.00
R5992:Vmn2r104 UTSW 17 20029485 missense probably damaging 1.00
R6066:Vmn2r104 UTSW 17 20038311 missense possibly damaging 0.69
R6156:Vmn2r104 UTSW 17 20041647 missense probably damaging 1.00
R6182:Vmn2r104 UTSW 17 20030245 missense probably benign 0.16
R6245:Vmn2r104 UTSW 17 20041567 missense possibly damaging 0.69
R6333:Vmn2r104 UTSW 17 20029586 missense probably benign 0.30
R6573:Vmn2r104 UTSW 17 20042225 missense probably damaging 1.00
R7101:Vmn2r104 UTSW 17 20030096 missense possibly damaging 0.65
R7123:Vmn2r104 UTSW 17 20040826 missense probably benign 0.12
R7485:Vmn2r104 UTSW 17 20029475 missense probably benign 0.01
R7514:Vmn2r104 UTSW 17 20029529 missense probably damaging 1.00
R7958:Vmn2r104 UTSW 17 20042726 missense probably benign
R8031:Vmn2r104 UTSW 17 20042786 missense probably benign 0.34
R8094:Vmn2r104 UTSW 17 20030221 missense possibly damaging 0.77
R8191:Vmn2r104 UTSW 17 20030203 missense possibly damaging 0.89
R8308:Vmn2r104 UTSW 17 20040778 missense possibly damaging 0.55
RF007:Vmn2r104 UTSW 17 20048040 missense probably benign 0.36
Z1177:Vmn2r104 UTSW 17 20029789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAAGTTCATATGTAAGAGTGCTG -3'
(R):5'- GTTAGACTCATTCCATGGAAGTTTC -3'

Sequencing Primer
(F):5'- AGAGTGCTGACAATAAAATACAGTAG -3'
(R):5'- CCATGGAAGTTTCATTTTTAGACAC -3'
Posted On2019-10-24