Incidental Mutation 'R7635:Cep350'
ID589847
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Namecentrosomal protein 350
Synonyms6430546F08Rik, 4933409L06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R7635 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location155844964-155973255 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 155879021 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 1949 (C1949*)
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138762]
Predicted Effect probably null
Transcript: ENSMUST00000129865
AA Change: C141*
Predicted Effect probably null
Transcript: ENSMUST00000138762
AA Change: C1949*
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: C1949*

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A C 9: 108,397,406 D236A probably damaging Het
2410089E03Rik A G 15: 8,226,920 I1955V probably benign Het
4833423E24Rik T A 2: 85,500,237 H242L probably benign Het
Adamts7 C T 9: 90,195,245 P1322S probably damaging Het
AI661453 A T 17: 47,467,751 T801S unknown Het
Alpk1 A G 3: 127,695,661 V123A probably benign Het
Ap2b1 T C 11: 83,389,728 V827A probably benign Het
Aqp5 T A 15: 99,594,178 I219N probably benign Het
Astn1 G A 1: 158,667,535 W1051* probably null Het
Atp8b1 T C 18: 64,573,305 D211G possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
Bsn A G 9: 108,110,990 V2521A unknown Het
Car7 T C 8: 104,548,437 V169A probably damaging Het
Catip T A 1: 74,368,962 D484E unknown Het
Ccdc18 T C 5: 108,229,049 probably null Het
Cdyl T C 13: 35,871,651 V518A probably damaging Het
Cinp A G 12: 110,884,013 V18A possibly damaging Het
Clec14a A G 12: 58,268,528 C103R probably damaging Het
Dnah8 G C 17: 30,785,107 E3655Q probably damaging Het
Dnajc11 T C 4: 151,968,611 I164T probably damaging Het
Dnajc13 A T 9: 104,162,367 M2101K probably benign Het
Ephb4 A G 5: 137,372,103 D864G probably damaging Het
Fkbp5 T C 17: 28,428,361 T167A probably benign Het
Foxf2 C A 13: 31,626,104 P9T unknown Het
Frmpd2 C A 14: 33,500,963 H105N possibly damaging Het
Gal3st3 C A 19: 5,307,406 R270S probably damaging Het
Galnt13 A G 2: 54,857,817 I237V probably damaging Het
Gata5 G T 2: 180,333,997 Q125K possibly damaging Het
Gm10036 T A 18: 15,833,289 F166I possibly damaging Het
Gm13084 T C 4: 143,810,417 E448G probably damaging Het
Gon4l A G 3: 88,895,106 N1008S probably benign Het
Got1l1 G A 8: 27,197,934 L356F probably damaging Het
Gse1 A G 8: 120,572,895 E888G unknown Het
Hmx1 C A 5: 35,392,239 P292Q possibly damaging Het
Igkv7-33 A T 6: 70,059,154 S16T probably benign Het
Itga2b C T 11: 102,461,756 G424D probably damaging Het
Itga6 A T 2: 71,843,233 K870N probably benign Het
Lama4 A T 10: 39,092,188 Q1442L probably benign Het
Lamc1 C T 1: 153,249,060 R655H probably damaging Het
Lclat1 C T 17: 73,161,936 S37L probably benign Het
Lrp1b A G 2: 41,123,597 probably null Het
Map3k20 T C 2: 72,402,004 S335P probably benign Het
Micu3 A G 8: 40,366,234 D318G possibly damaging Het
Mmp16 T C 4: 18,054,382 I296T probably benign Het
Mmp20 A T 9: 7,639,334 I168L probably benign Het
Mpp3 T C 11: 102,025,383 K48E probably damaging Het
Muc5ac A T 7: 141,805,676 D1291V probably damaging Het
Muc5ac A T 7: 141,805,753 T1317S possibly damaging Het
Myl10 A T 5: 136,700,864 M119L probably benign Het
Myo5b T A 18: 74,580,396 V104E probably damaging Het
Nek10 G A 14: 14,850,932 V326M probably benign Het
Olfr1348 G A 7: 6,501,582 L221F probably benign Het
Olfr323 T A 11: 58,625,164 E107D unknown Het
Olfr791 A T 10: 129,526,682 M152L probably benign Het
Pcnx A G 12: 81,919,125 T161A Het
Peg10 T C 6: 4,754,938 S240P probably damaging Het
Pex6 G A 17: 46,724,017 V822M probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Pld5 A T 1: 175,993,850 probably null Het
Plxna4 A G 6: 32,496,741 V447A probably damaging Het
Pou2af1 T C 9: 51,232,983 S66P probably benign Het
Prl2c2 T C 13: 12,997,343 D147G probably damaging Het
Prune1 A G 3: 95,255,285 L359P probably damaging Het
Rab4b A T 7: 27,176,217 V13E probably damaging Het
Rbbp6 T G 7: 122,976,008 V80G possibly damaging Het
Reep5 C T 18: 34,349,800 G119S possibly damaging Het
Rem1 G C 2: 152,634,665 R281P probably damaging Het
Rnf215 C T 11: 4,139,989 R309C probably damaging Het
Scn4a C A 11: 106,324,632 V1173F probably damaging Het
Serpine3 A T 14: 62,673,015 I186F possibly damaging Het
Slc7a1 A G 5: 148,352,236 V67A probably damaging Het
Smco2 A T 6: 146,860,009 E142V possibly damaging Het
Spata25 G A 2: 164,827,969 P41S probably benign Het
Specc1l A G 10: 75,276,804 D955G probably damaging Het
Spns3 C T 11: 72,539,034 probably null Het
Sptbn2 C T 19: 4,744,207 R1480C probably damaging Het
Taf1a T C 1: 183,408,434 probably null Het
Tas2r107 G T 6: 131,659,600 T162K possibly damaging Het
Tcea1 T C 1: 4,889,551 S139P probably benign Het
Tecta C T 9: 42,330,987 V2102I probably benign Het
Tmem131 A T 1: 36,872,548 I106K probably damaging Het
Tpbpb A G 13: 60,902,111 V68A probably benign Het
Ttc27 A T 17: 74,718,715 N61I probably benign Het
Ttn T C 2: 76,749,677 N23624S probably damaging Het
Usp2 T C 9: 44,067,222 probably null Het
Vmn1r10 A G 6: 57,114,041 H206R probably benign Het
Vmn1r234 T C 17: 21,229,217 I131T probably damaging Het
Vwf G T 6: 125,682,734 R2632L Het
Wdr36 T C 18: 32,850,525 L443P probably benign Het
Zcchc6 T C 13: 59,800,090 K806E probably benign Het
Zfp143 T C 7: 110,088,818 V489A probably benign Het
Zfp383 G A 7: 29,915,271 R317Q probably damaging Het
Zswim8 A G 14: 20,716,300 T839A probably damaging Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155940746 missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155862204 missense probably benign
IGL00837:Cep350 APN 1 155953391 missense probably damaging 1.00
IGL00977:Cep350 APN 1 155932865 missense probably null 0.99
IGL01544:Cep350 APN 1 155953187 missense probably damaging 1.00
IGL01616:Cep350 APN 1 155953247 missense probably benign 0.00
IGL01695:Cep350 APN 1 155944158 missense probably damaging 1.00
IGL01902:Cep350 APN 1 155861985 missense probably damaging 1.00
IGL01977:Cep350 APN 1 155911968 missense probably benign 0.01
IGL02388:Cep350 APN 1 155953753 missense probably benign 0.28
IGL02475:Cep350 APN 1 155862595 missense probably damaging 1.00
IGL02528:Cep350 APN 1 155894615 missense probably damaging 1.00
IGL02598:Cep350 APN 1 155862967 missense probably benign 0.00
IGL02676:Cep350 APN 1 155862231 missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155953222 missense probably benign 0.02
IGL02744:Cep350 APN 1 155931533 missense probably damaging 0.98
IGL02817:Cep350 APN 1 155928842 missense probably damaging 1.00
IGL02892:Cep350 APN 1 155868806 missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155858042 missense probably damaging 1.00
IGL03166:Cep350 APN 1 155863600 missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155860627 missense probably benign 0.06
IGL03268:Cep350 APN 1 155953549 missense probably benign 0.16
IGL03358:Cep350 APN 1 155928539 missense probably benign
primed UTSW 1 155953588 missense probably damaging 0.98
stoked UTSW 1 155915575 missense probably benign 0.03
NA:Cep350 UTSW 1 155958648 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0172:Cep350 UTSW 1 155953447 missense probably benign 0.00
R0365:Cep350 UTSW 1 155906571 missense probably benign 0.00
R0472:Cep350 UTSW 1 155914723 missense probably damaging 0.99
R0502:Cep350 UTSW 1 155900883 splice site probably null
R0538:Cep350 UTSW 1 155848620 missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155901435 splice site probably null
R0565:Cep350 UTSW 1 155961195 splice site probably benign
R0607:Cep350 UTSW 1 155872048 missense probably damaging 1.00
R0645:Cep350 UTSW 1 155940712 splice site probably null
R0675:Cep350 UTSW 1 155959753 missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155953246 missense probably benign 0.00
R0863:Cep350 UTSW 1 155862235 missense probably benign 0.00
R0969:Cep350 UTSW 1 155940826 missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155931518 missense probably damaging 1.00
R1186:Cep350 UTSW 1 155875376 missense probably damaging 1.00
R1552:Cep350 UTSW 1 155910738 missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155929079 missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155953358 missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155911981 missense probably benign 0.17
R1735:Cep350 UTSW 1 155953214 missense probably damaging 0.99
R1740:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R1783:Cep350 UTSW 1 155928865 missense probably damaging 1.00
R1844:Cep350 UTSW 1 155848628 missense probably damaging 0.99
R1848:Cep350 UTSW 1 155953651 missense probably benign 0.28
R1988:Cep350 UTSW 1 155933104 missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155914721 missense probably benign 0.16
R2241:Cep350 UTSW 1 155958556 splice site probably null
R2245:Cep350 UTSW 1 155879020 missense probably benign 0.10
R2402:Cep350 UTSW 1 155863136 missense probably benign
R2566:Cep350 UTSW 1 155959718 critical splice donor site probably null
R3160:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3162:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3769:Cep350 UTSW 1 155953204 missense probably damaging 1.00
R4035:Cep350 UTSW 1 155959795 missense probably benign 0.06
R4158:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4160:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4213:Cep350 UTSW 1 155935961 missense probably damaging 1.00
R4483:Cep350 UTSW 1 155926468 missense probably benign 0.01
R4648:Cep350 UTSW 1 155902598 missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155928586 missense probably damaging 1.00
R4836:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R4839:Cep350 UTSW 1 155928494 missense probably benign 0.00
R4969:Cep350 UTSW 1 155860279 missense probably damaging 0.99
R5014:Cep350 UTSW 1 155928206 missense probably benign 0.00
R5027:Cep350 UTSW 1 155933354 missense probably benign 0.01
R5144:Cep350 UTSW 1 155911150 missense probably damaging 0.99
R5153:Cep350 UTSW 1 155935946 missense probably damaging 1.00
R5165:Cep350 UTSW 1 155928368 missense probably damaging 1.00
R5182:Cep350 UTSW 1 155858108 missense probably damaging 1.00
R5445:Cep350 UTSW 1 155894723 missense probably benign 0.01
R5738:Cep350 UTSW 1 155866078 missense probably damaging 1.00
R5809:Cep350 UTSW 1 155933341 missense probably damaging 0.98
R5855:Cep350 UTSW 1 155953762 missense probably benign 0.00
R6103:Cep350 UTSW 1 155924576 missense probably benign 0.05
R6139:Cep350 UTSW 1 155953279 missense probably benign 0.03
R6285:Cep350 UTSW 1 155953374 missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155894673 missense probably damaging 1.00
R6446:Cep350 UTSW 1 155862154 missense probably benign
R6520:Cep350 UTSW 1 155933336 missense probably benign 0.02
R6712:Cep350 UTSW 1 155858106 missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155928551 missense probably benign 0.01
R7020:Cep350 UTSW 1 155928331 missense probably damaging 1.00
R7056:Cep350 UTSW 1 155848627 missense probably damaging 1.00
R7141:Cep350 UTSW 1 155914748 missense probably damaging 1.00
R7215:Cep350 UTSW 1 155894707 missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155910753 missense probably damaging 1.00
R7272:Cep350 UTSW 1 155953588 missense probably damaging 0.98
R7336:Cep350 UTSW 1 155862276 missense probably benign 0.17
R7361:Cep350 UTSW 1 155901491 missense probably damaging 1.00
R7390:Cep350 UTSW 1 155866087 missense possibly damaging 0.94
R7402:Cep350 UTSW 1 155928215 missense probably benign 0.00
R7428:Cep350 UTSW 1 155894619 missense probably benign 0.00
R7440:Cep350 UTSW 1 155940772 missense probably damaging 0.98
R7520:Cep350 UTSW 1 155915629 missense probably benign 0.05
R7529:Cep350 UTSW 1 155861923 missense probably benign 0.08
R7806:Cep350 UTSW 1 155862063 missense probably benign 0.00
R8100:Cep350 UTSW 1 155953402 missense probably damaging 0.97
R8192:Cep350 UTSW 1 155940783 missense possibly damaging 0.94
R8193:Cep350 UTSW 1 155862079 missense probably benign 0.01
R8351:Cep350 UTSW 1 155872034 missense probably damaging 0.99
R8406:Cep350 UTSW 1 155922418 missense probably benign 0.00
R8451:Cep350 UTSW 1 155872034 missense probably damaging 0.99
R8467:Cep350 UTSW 1 155915575 missense probably benign 0.03
R8543:Cep350 UTSW 1 155862376 missense probably damaging 0.98
R8714:Cep350 UTSW 1 155860731 missense probably damaging 0.98
R8810:Cep350 UTSW 1 155928116 missense probably damaging 1.00
R8837:Cep350 UTSW 1 155861772 missense probably benign 0.09
R8933:Cep350 UTSW 1 155863415 missense probably benign 0.01
RF020:Cep350 UTSW 1 155915478 missense probably benign 0.34
X0018:Cep350 UTSW 1 155953286 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTCGTAGCACACTGGCTTCC -3'
(R):5'- GTGTCAGCCAAAATTGCTAATGAAC -3'

Sequencing Primer
(F):5'- GTAGCACACTGGCTTCCCTAAG -3'
(R):5'- GTGGTTTTACGCTGAAAACAAGTC -3'
Posted On2019-10-24