Incidental Mutation 'R7635:Ccdc18'
ID 589869
Institutional Source Beutler Lab
Gene Symbol Ccdc18
Ensembl Gene ENSMUSG00000056531
Gene Name coiled-coil domain containing 18
Synonyms 1700021E15Rik, 4932411G06Rik
MMRRC Submission 045694-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7635 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 108280741-108381494 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 108376915 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047677]
AlphaFold Q640L5
Predicted Effect probably null
Transcript: ENSMUST00000047677
SMART Domains Protein: ENSMUSP00000036507
Gene: ENSMUSG00000056531

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
coiled coil region 168 320 N/A INTRINSIC
coiled coil region 344 405 N/A INTRINSIC
coiled coil region 507 1307 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A C 9: 108,274,605 (GRCm39) D236A probably damaging Het
Adamts7 C T 9: 90,077,298 (GRCm39) P1322S probably damaging Het
AI661453 A T 17: 47,778,676 (GRCm39) T801S unknown Het
Alpk1 A G 3: 127,489,310 (GRCm39) V123A probably benign Het
Ap2b1 T C 11: 83,280,554 (GRCm39) V827A probably benign Het
Aqp5 T A 15: 99,492,059 (GRCm39) I219N probably benign Het
Astn1 G A 1: 158,495,105 (GRCm39) W1051* probably null Het
Atp8b1 T C 18: 64,706,376 (GRCm39) D211G possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,448 (GRCm39) probably benign Het
Bsn A G 9: 107,988,189 (GRCm39) V2521A unknown Het
Car7 T C 8: 105,275,069 (GRCm39) V169A probably damaging Het
Catip T A 1: 74,408,121 (GRCm39) D484E unknown Het
Cdyl T C 13: 36,055,634 (GRCm39) V518A probably damaging Het
Cep350 A T 1: 155,754,767 (GRCm39) C1949* probably null Het
Cinp A G 12: 110,850,447 (GRCm39) V18A possibly damaging Het
Clec14a A G 12: 58,315,314 (GRCm39) C103R probably damaging Het
Cplane1 A G 15: 8,256,404 (GRCm39) I1955V probably benign Het
Dnah8 G C 17: 31,004,081 (GRCm39) E3655Q probably damaging Het
Dnajc11 T C 4: 152,053,068 (GRCm39) I164T probably damaging Het
Dnajc13 A T 9: 104,039,566 (GRCm39) M2101K probably benign Het
Ephb4 A G 5: 137,370,365 (GRCm39) D864G probably damaging Het
Fads2b T A 2: 85,330,581 (GRCm39) H242L probably benign Het
Fkbp5 T C 17: 28,647,335 (GRCm39) T167A probably benign Het
Foxf2 C A 13: 31,810,087 (GRCm39) P9T unknown Het
Frmpd2 C A 14: 33,222,920 (GRCm39) H105N possibly damaging Het
Gal3st3 C A 19: 5,357,434 (GRCm39) R270S probably damaging Het
Galnt13 A G 2: 54,747,829 (GRCm39) I237V probably damaging Het
Gata5 G T 2: 179,975,790 (GRCm39) Q125K possibly damaging Het
Gm10036 T A 18: 15,966,346 (GRCm39) F166I possibly damaging Het
Gon4l A G 3: 88,802,413 (GRCm39) N1008S probably benign Het
Got1l1 G A 8: 27,687,962 (GRCm39) L356F probably damaging Het
Gse1 A G 8: 121,299,634 (GRCm39) E888G unknown Het
Hmx1 C A 5: 35,549,583 (GRCm39) P292Q possibly damaging Het
Igkv7-33 A T 6: 70,036,138 (GRCm39) S16T probably benign Het
Itga2b C T 11: 102,352,582 (GRCm39) G424D probably damaging Het
Itga6 A T 2: 71,673,577 (GRCm39) K870N probably benign Het
Lama4 A T 10: 38,968,184 (GRCm39) Q1442L probably benign Het
Lamc1 C T 1: 153,124,806 (GRCm39) R655H probably damaging Het
Lclat1 C T 17: 73,468,931 (GRCm39) S37L probably benign Het
Lrp1b A G 2: 41,013,609 (GRCm39) probably null Het
Map3k20 T C 2: 72,232,348 (GRCm39) S335P probably benign Het
Micu3 A G 8: 40,819,275 (GRCm39) D318G possibly damaging Het
Mmp16 T C 4: 18,054,382 (GRCm39) I296T probably benign Het
Mmp20 A T 9: 7,639,335 (GRCm39) I168L probably benign Het
Mpp3 T C 11: 101,916,209 (GRCm39) K48E probably damaging Het
Muc5ac A T 7: 141,359,490 (GRCm39) T1317S possibly damaging Het
Muc5ac A T 7: 141,359,413 (GRCm39) D1291V probably damaging Het
Myl10 A T 5: 136,729,718 (GRCm39) M119L probably benign Het
Myo5b T A 18: 74,713,467 (GRCm39) V104E probably damaging Het
Nek10 G A 14: 14,850,932 (GRCm38) V326M probably benign Het
Or11l3 T A 11: 58,515,990 (GRCm39) E107D unknown Het
Or6c2 A T 10: 129,362,551 (GRCm39) M152L probably benign Het
Or6z1 G A 7: 6,504,581 (GRCm39) L221F probably benign Het
Pcnx1 A G 12: 81,965,899 (GRCm39) T161A Het
Peg10 T C 6: 4,754,938 (GRCm39) S240P probably damaging Het
Pex6 G A 17: 47,034,943 (GRCm39) V822M probably damaging Het
Pla2r1 T A 2: 60,365,106 (GRCm39) T155S probably benign Het
Pld5 A T 1: 175,821,416 (GRCm39) probably null Het
Plxna4 A G 6: 32,473,676 (GRCm39) V447A probably damaging Het
Pou2af1 T C 9: 51,144,283 (GRCm39) S66P probably benign Het
Pramel26 T C 4: 143,536,987 (GRCm39) E448G probably damaging Het
Prl2c2 T C 13: 13,171,928 (GRCm39) D147G probably damaging Het
Prune1 A G 3: 95,162,596 (GRCm39) L359P probably damaging Het
Rab4b A T 7: 26,875,642 (GRCm39) V13E probably damaging Het
Rbbp6 T G 7: 122,575,231 (GRCm39) V80G possibly damaging Het
Reep5 C T 18: 34,482,853 (GRCm39) G119S possibly damaging Het
Rem1 G C 2: 152,476,585 (GRCm39) R281P probably damaging Het
Rnf215 C T 11: 4,089,989 (GRCm39) R309C probably damaging Het
Scn4a C A 11: 106,215,458 (GRCm39) V1173F probably damaging Het
Serpine3 A T 14: 62,910,464 (GRCm39) I186F possibly damaging Het
Slc7a1 A G 5: 148,289,046 (GRCm39) V67A probably damaging Het
Smco2 A T 6: 146,761,507 (GRCm39) E142V possibly damaging Het
Spata25 G A 2: 164,669,889 (GRCm39) P41S probably benign Het
Specc1l A G 10: 75,112,638 (GRCm39) D955G probably damaging Het
Spns3 C T 11: 72,429,860 (GRCm39) probably null Het
Sptbn2 C T 19: 4,794,235 (GRCm39) R1480C probably damaging Het
Taf1a T C 1: 183,189,253 (GRCm39) probably null Het
Tas2r107 G T 6: 131,636,563 (GRCm39) T162K possibly damaging Het
Tcea1 T C 1: 4,959,774 (GRCm39) S139P probably benign Het
Tecta C T 9: 42,242,283 (GRCm39) V2102I probably benign Het
Tmem131 A T 1: 36,911,629 (GRCm39) I106K probably damaging Het
Tpbpb A G 13: 61,049,925 (GRCm39) V68A probably benign Het
Ttc27 A T 17: 75,025,710 (GRCm39) N61I probably benign Het
Ttn T C 2: 76,580,021 (GRCm39) N23624S probably damaging Het
Tut7 T C 13: 59,947,904 (GRCm39) K806E probably benign Het
Usp2 T C 9: 43,978,519 (GRCm39) probably null Het
Vmn1r10 A G 6: 57,091,026 (GRCm39) H206R probably benign Het
Vmn1r234 T C 17: 21,449,479 (GRCm39) I131T probably damaging Het
Vwf G T 6: 125,659,697 (GRCm39) R2632L Het
Wdr36 T C 18: 32,983,578 (GRCm39) L443P probably benign Het
Zfp143 T C 7: 109,688,025 (GRCm39) V489A probably benign Het
Zfp383 G A 7: 29,614,696 (GRCm39) R317Q probably damaging Het
Zswim8 A G 14: 20,766,368 (GRCm39) T839A probably damaging Het
Other mutations in Ccdc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Ccdc18 APN 5 108,328,391 (GRCm39) missense probably benign 0.01
IGL01380:Ccdc18 APN 5 108,328,753 (GRCm39) missense probably damaging 0.96
IGL01405:Ccdc18 APN 5 108,350,052 (GRCm39) splice site probably benign
IGL01718:Ccdc18 APN 5 108,349,214 (GRCm39) missense possibly damaging 0.81
IGL02098:Ccdc18 APN 5 108,349,977 (GRCm39) missense probably damaging 1.00
IGL02227:Ccdc18 APN 5 108,296,788 (GRCm39) missense possibly damaging 0.89
IGL02391:Ccdc18 APN 5 108,283,918 (GRCm39) missense probably damaging 1.00
IGL02794:Ccdc18 APN 5 108,319,614 (GRCm39) missense probably benign 0.00
IGL02808:Ccdc18 APN 5 108,283,835 (GRCm39) splice site probably benign
IGL02880:Ccdc18 APN 5 108,283,310 (GRCm39) missense probably benign 0.31
IGL03069:Ccdc18 APN 5 108,376,767 (GRCm39) missense probably damaging 1.00
IGL03390:Ccdc18 APN 5 108,359,997 (GRCm39) missense probably damaging 1.00
PIT4402001:Ccdc18 UTSW 5 108,306,485 (GRCm39) missense possibly damaging 0.94
R0004:Ccdc18 UTSW 5 108,309,566 (GRCm39) missense possibly damaging 0.52
R0112:Ccdc18 UTSW 5 108,321,627 (GRCm39) missense probably damaging 1.00
R0295:Ccdc18 UTSW 5 108,321,655 (GRCm39) missense probably damaging 1.00
R0546:Ccdc18 UTSW 5 108,322,830 (GRCm39) missense probably benign 0.06
R0619:Ccdc18 UTSW 5 108,328,282 (GRCm39) missense probably benign 0.04
R0648:Ccdc18 UTSW 5 108,322,853 (GRCm39) missense probably damaging 1.00
R0648:Ccdc18 UTSW 5 108,283,426 (GRCm39) missense probably damaging 0.99
R0666:Ccdc18 UTSW 5 108,311,530 (GRCm39) missense probably benign 0.19
R1271:Ccdc18 UTSW 5 108,349,982 (GRCm39) nonsense probably null
R1509:Ccdc18 UTSW 5 108,336,844 (GRCm39) missense possibly damaging 0.89
R1539:Ccdc18 UTSW 5 108,339,843 (GRCm39) missense probably damaging 1.00
R1542:Ccdc18 UTSW 5 108,360,054 (GRCm39) missense probably benign
R1663:Ccdc18 UTSW 5 108,363,956 (GRCm39) missense probably damaging 1.00
R1865:Ccdc18 UTSW 5 108,341,668 (GRCm39) missense probably benign 0.00
R1870:Ccdc18 UTSW 5 108,368,703 (GRCm39) missense possibly damaging 0.90
R1897:Ccdc18 UTSW 5 108,343,908 (GRCm39) missense probably benign 0.00
R1946:Ccdc18 UTSW 5 108,376,861 (GRCm39) missense probably damaging 1.00
R2420:Ccdc18 UTSW 5 108,376,454 (GRCm39) missense probably damaging 0.96
R2421:Ccdc18 UTSW 5 108,376,454 (GRCm39) missense probably damaging 0.96
R2422:Ccdc18 UTSW 5 108,376,454 (GRCm39) missense probably damaging 0.96
R4078:Ccdc18 UTSW 5 108,306,394 (GRCm39) nonsense probably null
R4079:Ccdc18 UTSW 5 108,306,394 (GRCm39) nonsense probably null
R4244:Ccdc18 UTSW 5 108,296,838 (GRCm39) nonsense probably null
R4409:Ccdc18 UTSW 5 108,368,708 (GRCm39) nonsense probably null
R4428:Ccdc18 UTSW 5 108,283,943 (GRCm39) missense probably benign 0.01
R4455:Ccdc18 UTSW 5 108,309,395 (GRCm39) missense possibly damaging 0.68
R4499:Ccdc18 UTSW 5 108,376,826 (GRCm39) missense possibly damaging 0.62
R4612:Ccdc18 UTSW 5 108,283,307 (GRCm39) missense probably benign 0.01
R4907:Ccdc18 UTSW 5 108,284,007 (GRCm39) missense probably benign 0.01
R4972:Ccdc18 UTSW 5 108,339,869 (GRCm39) missense probably benign
R5039:Ccdc18 UTSW 5 108,306,514 (GRCm39) critical splice donor site probably null
R5835:Ccdc18 UTSW 5 108,288,740 (GRCm39) missense possibly damaging 0.94
R5854:Ccdc18 UTSW 5 108,354,594 (GRCm39) missense possibly damaging 0.79
R6128:Ccdc18 UTSW 5 108,311,625 (GRCm39) missense possibly damaging 0.76
R6229:Ccdc18 UTSW 5 108,319,484 (GRCm39) missense probably benign 0.00
R6271:Ccdc18 UTSW 5 108,322,753 (GRCm39) missense possibly damaging 0.65
R6315:Ccdc18 UTSW 5 108,309,448 (GRCm39) missense probably benign
R6359:Ccdc18 UTSW 5 108,283,391 (GRCm39) missense probably damaging 1.00
R6375:Ccdc18 UTSW 5 108,322,820 (GRCm39) missense possibly damaging 0.79
R6388:Ccdc18 UTSW 5 108,349,214 (GRCm39) missense possibly damaging 0.81
R6415:Ccdc18 UTSW 5 108,309,612 (GRCm39) missense probably benign 0.03
R6560:Ccdc18 UTSW 5 108,339,790 (GRCm39) missense probably benign 0.09
R6645:Ccdc18 UTSW 5 108,286,796 (GRCm39) missense probably benign
R6664:Ccdc18 UTSW 5 108,315,966 (GRCm39) nonsense probably null
R6836:Ccdc18 UTSW 5 108,345,833 (GRCm39) missense probably damaging 1.00
R6947:Ccdc18 UTSW 5 108,309,401 (GRCm39) missense probably benign 0.26
R7009:Ccdc18 UTSW 5 108,321,728 (GRCm39) critical splice donor site probably null
R7052:Ccdc18 UTSW 5 108,309,554 (GRCm39) missense probably benign 0.15
R7058:Ccdc18 UTSW 5 108,341,664 (GRCm39) missense probably benign
R7087:Ccdc18 UTSW 5 108,343,988 (GRCm39) missense probably benign
R7117:Ccdc18 UTSW 5 108,296,835 (GRCm39) missense possibly damaging 0.95
R7176:Ccdc18 UTSW 5 108,315,972 (GRCm39) missense probably benign
R7382:Ccdc18 UTSW 5 108,286,873 (GRCm39) missense probably damaging 1.00
R7477:Ccdc18 UTSW 5 108,368,716 (GRCm39) missense probably damaging 0.98
R7493:Ccdc18 UTSW 5 108,354,483 (GRCm39) nonsense probably null
R7506:Ccdc18 UTSW 5 108,311,605 (GRCm39) missense possibly damaging 0.85
R7690:Ccdc18 UTSW 5 108,376,528 (GRCm39) missense probably benign 0.00
R7748:Ccdc18 UTSW 5 108,296,907 (GRCm39) critical splice donor site probably null
R7812:Ccdc18 UTSW 5 108,328,699 (GRCm39) missense probably benign 0.00
R8017:Ccdc18 UTSW 5 108,376,511 (GRCm39) nonsense probably null
R8019:Ccdc18 UTSW 5 108,376,511 (GRCm39) nonsense probably null
R8172:Ccdc18 UTSW 5 108,311,640 (GRCm39) critical splice donor site probably null
R8177:Ccdc18 UTSW 5 108,345,661 (GRCm39) missense possibly damaging 0.65
R8344:Ccdc18 UTSW 5 108,309,369 (GRCm39) missense possibly damaging 0.88
R8351:Ccdc18 UTSW 5 108,303,663 (GRCm39) missense probably damaging 1.00
R8415:Ccdc18 UTSW 5 108,363,899 (GRCm39) missense probably damaging 1.00
R8451:Ccdc18 UTSW 5 108,303,663 (GRCm39) missense probably damaging 1.00
R8547:Ccdc18 UTSW 5 108,345,725 (GRCm39) missense probably damaging 1.00
R8725:Ccdc18 UTSW 5 108,328,283 (GRCm39) missense possibly damaging 0.66
R9137:Ccdc18 UTSW 5 108,296,856 (GRCm39) missense probably damaging 0.98
R9391:Ccdc18 UTSW 5 108,376,770 (GRCm39) missense probably benign 0.02
R9418:Ccdc18 UTSW 5 108,303,669 (GRCm39) missense probably damaging 1.00
R9536:Ccdc18 UTSW 5 108,286,792 (GRCm39) missense probably benign 0.01
R9565:Ccdc18 UTSW 5 108,339,800 (GRCm39) missense probably damaging 0.99
RF013:Ccdc18 UTSW 5 108,368,582 (GRCm39) missense probably benign 0.05
X0024:Ccdc18 UTSW 5 108,339,788 (GRCm39) missense probably benign 0.01
X0063:Ccdc18 UTSW 5 108,360,063 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACCTACCTTTAACCCATTCAGAG -3'
(R):5'- TTTGAGGAAGCCTGGAACTTC -3'

Sequencing Primer
(F):5'- AGAGTCATTTAAACCTCTCCCG -3'
(R):5'- TTGAGGAAGCCTGGAACTTCTAACC -3'
Posted On 2019-10-24