Incidental Mutation 'R7635:Ephb4'
ID 589871
Institutional Source Beutler Lab
Gene Symbol Ephb4
Ensembl Gene ENSMUSG00000029710
Gene Name Eph receptor B4
Synonyms MDK2, Htk, b2b2412Clo, Myk1, Tyro11
MMRRC Submission 045694-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7635 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 137348371-137372784 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 137370365 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 864 (D864G)
Ref Sequence ENSEMBL: ENSMUSP00000106684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]
AlphaFold P54761
Predicted Effect probably damaging
Transcript: ENSMUST00000061244
AA Change: D855G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: D855G

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111054
AA Change: D855G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: D855G

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 1.4e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 3.4e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
Pfam:SAM_1 882 917 2.6e-7 PFAM
low complexity region 919 934 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111055
AA Change: D864G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: D864G

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 4.2e-10 PFAM
FN3 324 413 1.75e-6 SMART
FN3 443 525 1.07e-10 SMART
Pfam:EphA2_TM 550 621 5e-24 PFAM
TyrKc 624 883 5.09e-130 SMART
SAM 913 980 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144296
AA Change: D855G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: D855G

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166239
AA Change: D855G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: D855G

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A C 9: 108,274,605 (GRCm39) D236A probably damaging Het
Adamts7 C T 9: 90,077,298 (GRCm39) P1322S probably damaging Het
AI661453 A T 17: 47,778,676 (GRCm39) T801S unknown Het
Alpk1 A G 3: 127,489,310 (GRCm39) V123A probably benign Het
Ap2b1 T C 11: 83,280,554 (GRCm39) V827A probably benign Het
Aqp5 T A 15: 99,492,059 (GRCm39) I219N probably benign Het
Astn1 G A 1: 158,495,105 (GRCm39) W1051* probably null Het
Atp8b1 T C 18: 64,706,376 (GRCm39) D211G possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,448 (GRCm39) probably benign Het
Bsn A G 9: 107,988,189 (GRCm39) V2521A unknown Het
Car7 T C 8: 105,275,069 (GRCm39) V169A probably damaging Het
Catip T A 1: 74,408,121 (GRCm39) D484E unknown Het
Ccdc18 T C 5: 108,376,915 (GRCm39) probably null Het
Cdyl T C 13: 36,055,634 (GRCm39) V518A probably damaging Het
Cep350 A T 1: 155,754,767 (GRCm39) C1949* probably null Het
Cinp A G 12: 110,850,447 (GRCm39) V18A possibly damaging Het
Clec14a A G 12: 58,315,314 (GRCm39) C103R probably damaging Het
Cplane1 A G 15: 8,256,404 (GRCm39) I1955V probably benign Het
Dnah8 G C 17: 31,004,081 (GRCm39) E3655Q probably damaging Het
Dnajc11 T C 4: 152,053,068 (GRCm39) I164T probably damaging Het
Dnajc13 A T 9: 104,039,566 (GRCm39) M2101K probably benign Het
Fads2b T A 2: 85,330,581 (GRCm39) H242L probably benign Het
Fkbp5 T C 17: 28,647,335 (GRCm39) T167A probably benign Het
Foxf2 C A 13: 31,810,087 (GRCm39) P9T unknown Het
Frmpd2 C A 14: 33,222,920 (GRCm39) H105N possibly damaging Het
Gal3st3 C A 19: 5,357,434 (GRCm39) R270S probably damaging Het
Galnt13 A G 2: 54,747,829 (GRCm39) I237V probably damaging Het
Gata5 G T 2: 179,975,790 (GRCm39) Q125K possibly damaging Het
Gm10036 T A 18: 15,966,346 (GRCm39) F166I possibly damaging Het
Gon4l A G 3: 88,802,413 (GRCm39) N1008S probably benign Het
Got1l1 G A 8: 27,687,962 (GRCm39) L356F probably damaging Het
Gse1 A G 8: 121,299,634 (GRCm39) E888G unknown Het
Hmx1 C A 5: 35,549,583 (GRCm39) P292Q possibly damaging Het
Igkv7-33 A T 6: 70,036,138 (GRCm39) S16T probably benign Het
Itga2b C T 11: 102,352,582 (GRCm39) G424D probably damaging Het
Itga6 A T 2: 71,673,577 (GRCm39) K870N probably benign Het
Lama4 A T 10: 38,968,184 (GRCm39) Q1442L probably benign Het
Lamc1 C T 1: 153,124,806 (GRCm39) R655H probably damaging Het
Lclat1 C T 17: 73,468,931 (GRCm39) S37L probably benign Het
Lrp1b A G 2: 41,013,609 (GRCm39) probably null Het
Map3k20 T C 2: 72,232,348 (GRCm39) S335P probably benign Het
Micu3 A G 8: 40,819,275 (GRCm39) D318G possibly damaging Het
Mmp16 T C 4: 18,054,382 (GRCm39) I296T probably benign Het
Mmp20 A T 9: 7,639,335 (GRCm39) I168L probably benign Het
Mpp3 T C 11: 101,916,209 (GRCm39) K48E probably damaging Het
Muc5ac A T 7: 141,359,490 (GRCm39) T1317S possibly damaging Het
Muc5ac A T 7: 141,359,413 (GRCm39) D1291V probably damaging Het
Myl10 A T 5: 136,729,718 (GRCm39) M119L probably benign Het
Myo5b T A 18: 74,713,467 (GRCm39) V104E probably damaging Het
Nek10 G A 14: 14,850,932 (GRCm38) V326M probably benign Het
Or11l3 T A 11: 58,515,990 (GRCm39) E107D unknown Het
Or6c2 A T 10: 129,362,551 (GRCm39) M152L probably benign Het
Or6z1 G A 7: 6,504,581 (GRCm39) L221F probably benign Het
Pcnx1 A G 12: 81,965,899 (GRCm39) T161A Het
Peg10 T C 6: 4,754,938 (GRCm39) S240P probably damaging Het
Pex6 G A 17: 47,034,943 (GRCm39) V822M probably damaging Het
Pla2r1 T A 2: 60,365,106 (GRCm39) T155S probably benign Het
Pld5 A T 1: 175,821,416 (GRCm39) probably null Het
Plxna4 A G 6: 32,473,676 (GRCm39) V447A probably damaging Het
Pou2af1 T C 9: 51,144,283 (GRCm39) S66P probably benign Het
Pramel26 T C 4: 143,536,987 (GRCm39) E448G probably damaging Het
Prl2c2 T C 13: 13,171,928 (GRCm39) D147G probably damaging Het
Prune1 A G 3: 95,162,596 (GRCm39) L359P probably damaging Het
Rab4b A T 7: 26,875,642 (GRCm39) V13E probably damaging Het
Rbbp6 T G 7: 122,575,231 (GRCm39) V80G possibly damaging Het
Reep5 C T 18: 34,482,853 (GRCm39) G119S possibly damaging Het
Rem1 G C 2: 152,476,585 (GRCm39) R281P probably damaging Het
Rnf215 C T 11: 4,089,989 (GRCm39) R309C probably damaging Het
Scn4a C A 11: 106,215,458 (GRCm39) V1173F probably damaging Het
Serpine3 A T 14: 62,910,464 (GRCm39) I186F possibly damaging Het
Slc7a1 A G 5: 148,289,046 (GRCm39) V67A probably damaging Het
Smco2 A T 6: 146,761,507 (GRCm39) E142V possibly damaging Het
Spata25 G A 2: 164,669,889 (GRCm39) P41S probably benign Het
Specc1l A G 10: 75,112,638 (GRCm39) D955G probably damaging Het
Spns3 C T 11: 72,429,860 (GRCm39) probably null Het
Sptbn2 C T 19: 4,794,235 (GRCm39) R1480C probably damaging Het
Taf1a T C 1: 183,189,253 (GRCm39) probably null Het
Tas2r107 G T 6: 131,636,563 (GRCm39) T162K possibly damaging Het
Tcea1 T C 1: 4,959,774 (GRCm39) S139P probably benign Het
Tecta C T 9: 42,242,283 (GRCm39) V2102I probably benign Het
Tmem131 A T 1: 36,911,629 (GRCm39) I106K probably damaging Het
Tpbpb A G 13: 61,049,925 (GRCm39) V68A probably benign Het
Ttc27 A T 17: 75,025,710 (GRCm39) N61I probably benign Het
Ttn T C 2: 76,580,021 (GRCm39) N23624S probably damaging Het
Tut7 T C 13: 59,947,904 (GRCm39) K806E probably benign Het
Usp2 T C 9: 43,978,519 (GRCm39) probably null Het
Vmn1r10 A G 6: 57,091,026 (GRCm39) H206R probably benign Het
Vmn1r234 T C 17: 21,449,479 (GRCm39) I131T probably damaging Het
Vwf G T 6: 125,659,697 (GRCm39) R2632L Het
Wdr36 T C 18: 32,983,578 (GRCm39) L443P probably benign Het
Zfp143 T C 7: 109,688,025 (GRCm39) V489A probably benign Het
Zfp383 G A 7: 29,614,696 (GRCm39) R317Q probably damaging Het
Zswim8 A G 14: 20,766,368 (GRCm39) T839A probably damaging Het
Other mutations in Ephb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Ephb4 APN 5 137,363,877 (GRCm39) splice site probably benign
IGL00948:Ephb4 APN 5 137,364,921 (GRCm39) missense probably damaging 1.00
IGL01653:Ephb4 APN 5 137,364,003 (GRCm39) splice site probably benign
IGL01885:Ephb4 APN 5 137,356,059 (GRCm39) missense probably damaging 1.00
IGL01906:Ephb4 APN 5 137,359,456 (GRCm39) missense probably damaging 1.00
IGL02089:Ephb4 APN 5 137,369,024 (GRCm39) missense probably damaging 0.98
IGL02216:Ephb4 APN 5 137,370,332 (GRCm39) missense possibly damaging 0.92
IGL02233:Ephb4 APN 5 137,352,763 (GRCm39) nonsense probably null
IGL03080:Ephb4 APN 5 137,352,345 (GRCm39) splice site probably benign
IGL03111:Ephb4 APN 5 137,370,767 (GRCm39) missense probably benign 0.07
R0599:Ephb4 UTSW 5 137,368,117 (GRCm39) missense probably damaging 1.00
R0744:Ephb4 UTSW 5 137,363,929 (GRCm39) missense probably damaging 1.00
R1331:Ephb4 UTSW 5 137,364,796 (GRCm39) splice site probably benign
R1441:Ephb4 UTSW 5 137,359,509 (GRCm39) missense probably damaging 1.00
R1732:Ephb4 UTSW 5 137,370,440 (GRCm39) missense possibly damaging 0.93
R1745:Ephb4 UTSW 5 137,358,696 (GRCm39) missense probably benign
R1831:Ephb4 UTSW 5 137,352,677 (GRCm39) missense probably damaging 1.00
R1865:Ephb4 UTSW 5 137,361,572 (GRCm39) missense possibly damaging 0.53
R2165:Ephb4 UTSW 5 137,352,688 (GRCm39) missense probably benign 0.08
R2206:Ephb4 UTSW 5 137,355,981 (GRCm39) missense probably damaging 1.00
R2473:Ephb4 UTSW 5 137,363,962 (GRCm39) missense probably benign 0.15
R4779:Ephb4 UTSW 5 137,363,964 (GRCm39) missense probably benign 0.04
R4801:Ephb4 UTSW 5 137,363,768 (GRCm39) missense probably damaging 1.00
R4802:Ephb4 UTSW 5 137,363,768 (GRCm39) missense probably damaging 1.00
R5307:Ephb4 UTSW 5 137,361,574 (GRCm39) missense probably damaging 1.00
R5452:Ephb4 UTSW 5 137,359,404 (GRCm39) missense probably damaging 1.00
R5458:Ephb4 UTSW 5 137,368,114 (GRCm39) missense probably damaging 1.00
R5475:Ephb4 UTSW 5 137,352,701 (GRCm39) missense probably benign 0.00
R5662:Ephb4 UTSW 5 137,370,457 (GRCm39) missense probably damaging 0.98
R5879:Ephb4 UTSW 5 137,358,678 (GRCm39) missense probably benign 0.00
R6336:Ephb4 UTSW 5 137,370,347 (GRCm39) missense probably damaging 1.00
R6443:Ephb4 UTSW 5 137,358,711 (GRCm39) missense probably damaging 1.00
R6632:Ephb4 UTSW 5 137,364,849 (GRCm39) missense probably damaging 0.99
R6973:Ephb4 UTSW 5 137,368,066 (GRCm39) missense probably damaging 1.00
R7008:Ephb4 UTSW 5 137,359,536 (GRCm39) missense probably benign 0.00
R7145:Ephb4 UTSW 5 137,370,308 (GRCm39) missense probably damaging 1.00
R7421:Ephb4 UTSW 5 137,352,687 (GRCm39) missense possibly damaging 0.88
R7593:Ephb4 UTSW 5 137,359,560 (GRCm39) missense probably benign
R7751:Ephb4 UTSW 5 137,363,937 (GRCm39) missense probably damaging 1.00
R7825:Ephb4 UTSW 5 137,370,699 (GRCm39) missense probably damaging 1.00
R8539:Ephb4 UTSW 5 137,356,117 (GRCm39) missense probably damaging 1.00
R8904:Ephb4 UTSW 5 137,369,067 (GRCm39) missense probably damaging 1.00
R9228:Ephb4 UTSW 5 137,352,824 (GRCm39) missense possibly damaging 0.79
R9327:Ephb4 UTSW 5 137,361,529 (GRCm39) missense probably damaging 0.99
R9513:Ephb4 UTSW 5 137,361,564 (GRCm39) missense possibly damaging 0.76
R9659:Ephb4 UTSW 5 137,363,743 (GRCm39) missense probably damaging 1.00
R9788:Ephb4 UTSW 5 137,363,743 (GRCm39) missense probably damaging 1.00
X0026:Ephb4 UTSW 5 137,371,820 (GRCm39) missense probably damaging 1.00
Z1177:Ephb4 UTSW 5 137,359,621 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGCAGTTTTCGTCCTCCTG -3'
(R):5'- GACCAGTCTATACACAAAGGCATGG -3'

Sequencing Primer
(F):5'- CTGGGACTCAGGGGGTCTG -3'
(R):5'- GTCTATACACAAAGGCATGGGTACTC -3'
Posted On 2019-10-24