Incidental Mutation 'R7635:Plxna4'
ID589874
Institutional Source Beutler Lab
Gene Symbol Plxna4
Ensembl Gene ENSMUSG00000029765
Gene Nameplexin A4
SynonymsPlxa4
MMRRC Submission
Accession Numbers

Genbank: NM_175750

Is this an essential gene? Possibly essential (E-score: 0.588) question?
Stock #R7635 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location32144268-32588192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32496741 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 447 (V447A)
Ref Sequence ENSEMBL: ENSMUSP00000110748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115096]
Predicted Effect probably damaging
Transcript: ENSMUST00000115096
AA Change: V447A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: V447A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 490 2.3e-131 SMART
PSI 508 558 2.21e-14 SMART
PSI 654 701 2.44e-7 SMART
PSI 802 855 1.2e-6 SMART
IPT 856 950 7.25e-16 SMART
IPT 952 1036 4.1e-15 SMART
IPT 1038 1138 2.86e-14 SMART
IPT 1140 1229 6.88e-1 SMART
transmembrane domain 1237 1259 N/A INTRINSIC
Pfam:Plexin_cytopl 1310 1863 1.8e-264 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A C 9: 108,397,406 D236A probably damaging Het
2410089E03Rik A G 15: 8,226,920 I1955V probably benign Het
4833423E24Rik T A 2: 85,500,237 H242L probably benign Het
Adamts7 C T 9: 90,195,245 P1322S probably damaging Het
AI661453 A T 17: 47,467,751 T801S unknown Het
Alpk1 A G 3: 127,695,661 V123A probably benign Het
Ap2b1 T C 11: 83,389,728 V827A probably benign Het
Aqp5 T A 15: 99,594,178 I219N probably benign Het
Astn1 G A 1: 158,667,535 W1051* probably null Het
Atp8b1 T C 18: 64,573,305 D211G possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
Bsn A G 9: 108,110,990 V2521A unknown Het
Car7 T C 8: 104,548,437 V169A probably damaging Het
Catip T A 1: 74,368,962 D484E unknown Het
Ccdc18 T C 5: 108,229,049 probably null Het
Cdyl T C 13: 35,871,651 V518A probably damaging Het
Cep350 A T 1: 155,879,021 C1949* probably null Het
Cinp A G 12: 110,884,013 V18A possibly damaging Het
Clec14a A G 12: 58,268,528 C103R probably damaging Het
Dnah8 G C 17: 30,785,107 E3655Q probably damaging Het
Dnajc11 T C 4: 151,968,611 I164T probably damaging Het
Dnajc13 A T 9: 104,162,367 M2101K probably benign Het
Ephb4 A G 5: 137,372,103 D864G probably damaging Het
Fkbp5 T C 17: 28,428,361 T167A probably benign Het
Foxf2 C A 13: 31,626,104 P9T unknown Het
Frmpd2 C A 14: 33,500,963 H105N possibly damaging Het
Gal3st3 C A 19: 5,307,406 R270S probably damaging Het
Galnt13 A G 2: 54,857,817 I237V probably damaging Het
Gata5 G T 2: 180,333,997 Q125K possibly damaging Het
Gm10036 T A 18: 15,833,289 F166I possibly damaging Het
Gm13084 T C 4: 143,810,417 E448G probably damaging Het
Gon4l A G 3: 88,895,106 N1008S probably benign Het
Got1l1 G A 8: 27,197,934 L356F probably damaging Het
Gse1 A G 8: 120,572,895 E888G unknown Het
Hmx1 C A 5: 35,392,239 P292Q possibly damaging Het
Igkv7-33 A T 6: 70,059,154 S16T probably benign Het
Itga2b C T 11: 102,461,756 G424D probably damaging Het
Itga6 A T 2: 71,843,233 K870N probably benign Het
Lama4 A T 10: 39,092,188 Q1442L probably benign Het
Lamc1 C T 1: 153,249,060 R655H probably damaging Het
Lclat1 C T 17: 73,161,936 S37L probably benign Het
Lrp1b A G 2: 41,123,597 probably null Het
Map3k20 T C 2: 72,402,004 S335P probably benign Het
Micu3 A G 8: 40,366,234 D318G possibly damaging Het
Mmp16 T C 4: 18,054,382 I296T probably benign Het
Mmp20 A T 9: 7,639,334 I168L probably benign Het
Mpp3 T C 11: 102,025,383 K48E probably damaging Het
Muc5ac A T 7: 141,805,676 D1291V probably damaging Het
Muc5ac A T 7: 141,805,753 T1317S possibly damaging Het
Myl10 A T 5: 136,700,864 M119L probably benign Het
Myo5b T A 18: 74,580,396 V104E probably damaging Het
Nek10 G A 14: 14,850,932 V326M probably benign Het
Olfr1348 G A 7: 6,501,582 L221F probably benign Het
Olfr323 T A 11: 58,625,164 E107D unknown Het
Olfr791 A T 10: 129,526,682 M152L probably benign Het
Pcnx A G 12: 81,919,125 T161A Het
Peg10 T C 6: 4,754,938 S240P probably damaging Het
Pex6 G A 17: 46,724,017 V822M probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Pld5 A T 1: 175,993,850 probably null Het
Pou2af1 T C 9: 51,232,983 S66P probably benign Het
Prl2c2 T C 13: 12,997,343 D147G probably damaging Het
Prune1 A G 3: 95,255,285 L359P probably damaging Het
Rab4b A T 7: 27,176,217 V13E probably damaging Het
Rbbp6 T G 7: 122,976,008 V80G possibly damaging Het
Reep5 C T 18: 34,349,800 G119S possibly damaging Het
Rem1 G C 2: 152,634,665 R281P probably damaging Het
Rnf215 C T 11: 4,139,989 R309C probably damaging Het
Scn4a C A 11: 106,324,632 V1173F probably damaging Het
Serpine3 A T 14: 62,673,015 I186F possibly damaging Het
Slc7a1 A G 5: 148,352,236 V67A probably damaging Het
Smco2 A T 6: 146,860,009 E142V possibly damaging Het
Spata25 G A 2: 164,827,969 P41S probably benign Het
Specc1l A G 10: 75,276,804 D955G probably damaging Het
Spns3 C T 11: 72,539,034 probably null Het
Sptbn2 C T 19: 4,744,207 R1480C probably damaging Het
Taf1a T C 1: 183,408,434 probably null Het
Tas2r107 G T 6: 131,659,600 T162K possibly damaging Het
Tcea1 T C 1: 4,889,551 S139P probably benign Het
Tecta C T 9: 42,330,987 V2102I probably benign Het
Tmem131 A T 1: 36,872,548 I106K probably damaging Het
Tpbpb A G 13: 60,902,111 V68A probably benign Het
Ttc27 A T 17: 74,718,715 N61I probably benign Het
Ttn T C 2: 76,749,677 N23624S probably damaging Het
Usp2 T C 9: 44,067,222 probably null Het
Vmn1r10 A G 6: 57,114,041 H206R probably benign Het
Vmn1r234 T C 17: 21,229,217 I131T probably damaging Het
Vwf G T 6: 125,682,734 R2632L Het
Wdr36 T C 18: 32,850,525 L443P probably benign Het
Zcchc6 T C 13: 59,800,090 K806E probably benign Het
Zfp143 T C 7: 110,088,818 V489A probably benign Het
Zfp383 G A 7: 29,915,271 R317Q probably damaging Het
Zswim8 A G 14: 20,716,300 T839A probably damaging Het
Other mutations in Plxna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Plxna4 APN 6 32162091 missense probably damaging 1.00
IGL01395:Plxna4 APN 6 32239433 missense probably damaging 0.99
IGL01506:Plxna4 APN 6 32516535 missense probably damaging 1.00
IGL01606:Plxna4 APN 6 32158001 missense probably damaging 1.00
IGL01753:Plxna4 APN 6 32310478 missense probably benign 0.06
IGL01767:Plxna4 APN 6 32237678 missense possibly damaging 0.51
IGL01968:Plxna4 APN 6 32215204 missense possibly damaging 0.81
IGL02109:Plxna4 APN 6 32215641 missense probably benign
IGL02299:Plxna4 APN 6 32165156 missense probably benign 0.01
IGL02306:Plxna4 APN 6 32206124 missense probably benign 0.19
IGL02312:Plxna4 APN 6 32165117 missense possibly damaging 0.79
IGL02326:Plxna4 APN 6 32152905 missense probably damaging 0.99
IGL02658:Plxna4 APN 6 32185411 missense probably damaging 1.00
IGL02683:Plxna4 APN 6 32517606 missense probably benign 0.03
IGL02701:Plxna4 APN 6 32517559 missense probably benign 0.01
IGL02995:Plxna4 APN 6 32516595 missense probably damaging 1.00
IGL03030:Plxna4 APN 6 32202225 missense probably benign 0.01
IGL03264:Plxna4 APN 6 32178402 missense possibly damaging 0.64
IGL03304:Plxna4 APN 6 32165051 splice site probably benign
IGL03382:Plxna4 APN 6 32202194 missense probably benign 0.23
corona UTSW 6 32517264 missense probably damaging 1.00
inclined UTSW 6 32237723 nonsense probably null
Slope UTSW 6 32234606 missense probably benign 0.00
G4846:Plxna4 UTSW 6 32192272 missense probably damaging 1.00
R0133:Plxna4 UTSW 6 32197074 missense probably benign 0.00
R0200:Plxna4 UTSW 6 32197088 missense probably damaging 0.99
R0308:Plxna4 UTSW 6 32237768 missense probably benign 0.01
R0468:Plxna4 UTSW 6 32215246 missense probably damaging 1.00
R0505:Plxna4 UTSW 6 32202119 missense probably benign
R0542:Plxna4 UTSW 6 32192297 missense probably damaging 1.00
R0548:Plxna4 UTSW 6 32158015 missense probably damaging 1.00
R0652:Plxna4 UTSW 6 32185501 missense probably damaging 1.00
R1144:Plxna4 UTSW 6 32197156 missense possibly damaging 0.58
R1190:Plxna4 UTSW 6 32251136 missense probably damaging 1.00
R1228:Plxna4 UTSW 6 32224152 splice site probably null
R1569:Plxna4 UTSW 6 32185475 missense possibly damaging 0.78
R1803:Plxna4 UTSW 6 32517444 missense probably damaging 0.98
R1832:Plxna4 UTSW 6 32197826 missense probably benign 0.01
R2068:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R2157:Plxna4 UTSW 6 32516974 missense probably benign 0.00
R2842:Plxna4 UTSW 6 32215631 critical splice donor site probably null
R2849:Plxna4 UTSW 6 32185532 missense probably damaging 1.00
R2892:Plxna4 UTSW 6 32517037 missense probably damaging 1.00
R2930:Plxna4 UTSW 6 32165780 missense probably damaging 1.00
R3892:Plxna4 UTSW 6 32215654 missense probably damaging 1.00
R4065:Plxna4 UTSW 6 32236365 nonsense probably null
R4276:Plxna4 UTSW 6 32200948 missense probably benign 0.29
R4307:Plxna4 UTSW 6 32163509 missense probably damaging 0.99
R4331:Plxna4 UTSW 6 32150545 nonsense probably null
R4478:Plxna4 UTSW 6 32196133 missense possibly damaging 0.89
R4529:Plxna4 UTSW 6 32496896 critical splice acceptor site probably null
R4566:Plxna4 UTSW 6 32517403 missense probably benign 0.00
R4568:Plxna4 UTSW 6 32152938 missense probably damaging 1.00
R4664:Plxna4 UTSW 6 32516950 missense possibly damaging 0.88
R4685:Plxna4 UTSW 6 32165844 missense probably damaging 1.00
R4701:Plxna4 UTSW 6 32516688 missense probably damaging 0.99
R4939:Plxna4 UTSW 6 32165762 missense probably damaging 1.00
R5153:Plxna4 UTSW 6 32224159 splice site probably null
R5181:Plxna4 UTSW 6 32516997 missense probably damaging 1.00
R5256:Plxna4 UTSW 6 32251072 missense probably benign 0.03
R5259:Plxna4 UTSW 6 32517021 missense possibly damaging 0.89
R5306:Plxna4 UTSW 6 32206121 missense probably damaging 0.99
R5487:Plxna4 UTSW 6 32517283 missense probably damaging 1.00
R5510:Plxna4 UTSW 6 32178358 missense probably damaging 0.96
R5542:Plxna4 UTSW 6 32206230 missense probably damaging 1.00
R5567:Plxna4 UTSW 6 32157980 missense possibly damaging 0.61
R5634:Plxna4 UTSW 6 32237723 nonsense probably null
R5653:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R5665:Plxna4 UTSW 6 32215722 missense probably damaging 1.00
R5845:Plxna4 UTSW 6 32237776 missense probably damaging 1.00
R5909:Plxna4 UTSW 6 32517246 missense probably damaging 1.00
R5938:Plxna4 UTSW 6 32234606 missense probably benign 0.00
R5973:Plxna4 UTSW 6 32251065 splice site probably null
R6433:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6482:Plxna4 UTSW 6 32516737 missense probably benign
R6560:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6721:Plxna4 UTSW 6 32200859 missense probably benign 0.26
R6810:Plxna4 UTSW 6 32310522 missense probably benign 0.18
R6985:Plxna4 UTSW 6 32237708 missense probably damaging 1.00
R7024:Plxna4 UTSW 6 32192269 missense probably damaging 1.00
R7046:Plxna4 UTSW 6 32516505 missense probably damaging 1.00
R7137:Plxna4 UTSW 6 32517264 missense probably damaging 1.00
R7163:Plxna4 UTSW 6 32496756 missense probably benign 0.01
R7199:Plxna4 UTSW 6 32215178 nonsense probably null
R7248:Plxna4 UTSW 6 32162160 missense probably damaging 0.99
R7260:Plxna4 UTSW 6 32239520 missense possibly damaging 0.79
R7361:Plxna4 UTSW 6 32196122 critical splice donor site probably null
R7383:Plxna4 UTSW 6 32152799 critical splice donor site probably null
R7405:Plxna4 UTSW 6 32196319 missense probably benign 0.00
R7516:Plxna4 UTSW 6 32237768 missense probably benign 0.00
R7754:Plxna4 UTSW 6 32152872 missense probably damaging 1.00
R7763:Plxna4 UTSW 6 32223980 missense probably damaging 0.99
R7789:Plxna4 UTSW 6 32206233 critical splice acceptor site probably null
R8167:Plxna4 UTSW 6 32517046 missense probably damaging 0.99
R8191:Plxna4 UTSW 6 32516950 missense possibly damaging 0.88
R8225:Plxna4 UTSW 6 32162103 missense probably damaging 1.00
R8284:Plxna4 UTSW 6 32152854 missense probably benign 0.25
R8305:Plxna4 UTSW 6 32211065 missense possibly damaging 0.81
R8438:Plxna4 UTSW 6 32202180 missense probably damaging 1.00
V1024:Plxna4 UTSW 6 32234574 missense probably damaging 1.00
X0027:Plxna4 UTSW 6 32517044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGATTCGCACAACAG -3'
(R):5'- ACACTGGTGCAGTTTCCCAC -3'

Sequencing Primer
(F):5'- TGATTCGCACAACAGCCTAC -3'
(R):5'- GGTGCAGTTTCCCACGTTGTTC -3'
Posted On2019-10-24