Mutagenetix > Incidental Mutation

Incidental Mutation 'R7635:Vwf'

589877

Institutional Source

Beutler Lab

Gene Symbol

Vwf

Ensembl Gene

ENSMUSG00000001930

Gene Name

Von Willebrand factor

Synonyms

6820430P06Rik, B130011O06Rik

MMRRC Submission

Accession Numbers

Genbank: NM_011708; MGI: 98941

Essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R7635 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

125546774-125686679 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 125682734 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 2632 (R2632L)

Ref Sequence

ENSEMBL: ENSMUSP00000107873 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112254]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: R2632L

Domain	Start	End	E-Value	Type
VWD	23	181	3.43e-35	SMART
C8	221	295	1.11e-21	SMART
Pfam:TIL	298	351	6.9e-15	PFAM
VWC	353	413	8.71e-1	SMART
VWD	380	543	2.93e-52	SMART
C8	580	652	3.82e-25	SMART
Pfam:TIL	655	710	4.1e-14	PFAM
EGF_like	790	825	4.37e1	SMART
VWC	832	901	3.29e-3	SMART
VWD	859	1015	5.15e-39	SMART
C8	1056	1130	1.01e-33	SMART
Pfam:TIL	1144	1199	1.3e-9	PFAM
VWA	1278	1461	1.81e-20	SMART
low complexity region	1464	1477	N/A	INTRINSIC
VWA	1499	1672	8.43e-39	SMART
VWA	1692	1875	2.83e-31	SMART
VWC	1882	1949	2.99e0	SMART
VWD	1941	2104	5.03e-42	SMART
C8	2135	2203	1.29e-13	SMART
Pfam:TIL	2206	2257	8.3e-8	PFAM
VWC	2260	2328	3.16e-16	SMART
low complexity region	2417	2428	N/A	INTRINSIC
VWC	2434	2497	2.61e-17	SMART
VWC	2513	2577	3.37e0	SMART
VWC	2585	2647	2.55e-11	SMART
CT	2730	2815	1.37e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000147101

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]

Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700102P08Rik	A	C	9: 108,397,406	D236A	probably damaging	Het
2410089E03Rik	A	G	15: 8,226,920	I1955V	probably benign	Het
4833423E24Rik	T	A	2: 85,500,237	H242L	probably benign	Het
Adamts7	C	T	9: 90,195,245	P1322S	probably damaging	Het
AI661453	A	T	17: 47,467,751	T801S	unknown	Het
Alpk1	A	G	3: 127,695,661	V123A	probably benign	Het
Ap2b1	T	C	11: 83,389,728	V827A	probably benign	Het
Aqp5	T	A	15: 99,594,178	I219N	probably benign	Het
Astn1	G	A	1: 158,667,535	W1051*	probably null	Het
Atp8b1	T	C	18: 64,573,305	D211G	possibly damaging	Het
BC028528	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	3: 95,888,136		probably benign	Het
Bsn	A	G	9: 108,110,990	V2521A	unknown	Het
Car7	T	C	8: 104,548,437	V169A	probably damaging	Het
Catip	T	A	1: 74,368,962	D484E	unknown	Het
Ccdc18	T	C	5: 108,229,049		probably null	Het
Cdyl	T	C	13: 35,871,651	V518A	probably damaging	Het
Cep350	A	T	1: 155,879,021	C1949*	probably null	Het
Cinp	A	G	12: 110,884,013	V18A	possibly damaging	Het
Clec14a	A	G	12: 58,268,528	C103R	probably damaging	Het
Dnah8	G	C	17: 30,785,107	E3655Q	probably damaging	Het
Dnajc11	T	C	4: 151,968,611	I164T	probably damaging	Het
Dnajc13	A	T	9: 104,162,367	M2101K	probably benign	Het
Ephb4	A	G	5: 137,372,103	D864G	probably damaging	Het
Fkbp5	T	C	17: 28,428,361	T167A	probably benign	Het
Foxf2	C	A	13: 31,626,104	P9T	unknown	Het
Frmpd2	C	A	14: 33,500,963	H105N	possibly damaging	Het
Gal3st3	C	A	19: 5,307,406	R270S	probably damaging	Het
Galnt13	A	G	2: 54,857,817	I237V	probably damaging	Het
Gata5	G	T	2: 180,333,997	Q125K	possibly damaging	Het
Gm10036	T	A	18: 15,833,289	F166I	possibly damaging	Het
Gm13084	T	C	4: 143,810,417	E448G	probably damaging	Het
Gon4l	A	G	3: 88,895,106	N1008S	probably benign	Het
Got1l1	G	A	8: 27,197,934	L356F	probably damaging	Het
Gse1	A	G	8: 120,572,895	E888G	unknown	Het
Hmx1	C	A	5: 35,392,239	P292Q	possibly damaging	Het
Igkv7-33	A	T	6: 70,059,154	S16T	probably benign	Het
Itga2b	C	T	11: 102,461,756	G424D	probably damaging	Het
Itga6	A	T	2: 71,843,233	K870N	probably benign	Het
Lama4	A	T	10: 39,092,188	Q1442L	probably benign	Het
Lamc1	C	T	1: 153,249,060	R655H	probably damaging	Het
Lclat1	C	T	17: 73,161,936	S37L	probably benign	Het
Lrp1b	A	G	2: 41,123,597		probably null	Het
Map3k20	T	C	2: 72,402,004	S335P	probably benign	Het
Micu3	A	G	8: 40,366,234	D318G	possibly damaging	Het
Mmp16	T	C	4: 18,054,382	I296T	probably benign	Het
Mmp20	A	T	9: 7,639,334	I168L	probably benign	Het
Mpp3	T	C	11: 102,025,383	K48E	probably damaging	Het
Muc5ac	A	T	7: 141,805,676	D1291V	probably damaging	Het
Muc5ac	A	T	7: 141,805,753	T1317S	possibly damaging	Het
Myl10	A	T	5: 136,700,864	M119L	probably benign	Het
Myo5b	T	A	18: 74,580,396	V104E	probably damaging	Het
Nek10	G	A	14: 14,850,932	V326M	probably benign	Het
Olfr1348	G	A	7: 6,501,582	L221F	probably benign	Het
Olfr323	T	A	11: 58,625,164	E107D	unknown	Het
Olfr791	A	T	10: 129,526,682	M152L	probably benign	Het
Pcnx	A	G	12: 81,919,125	T161A		Het
Peg10	T	C	6: 4,754,938	S240P	probably damaging	Het
Pex6	G	A	17: 46,724,017	V822M	probably damaging	Het
Pla2r1	T	A	2: 60,534,762	T155S	probably benign	Het
Pld5	A	T	1: 175,993,850		probably null	Het
Plxna4	A	G	6: 32,496,741	V447A	probably damaging	Het
Pou2af1	T	C	9: 51,232,983	S66P	probably benign	Het
Prl2c2	T	C	13: 12,997,343	D147G	probably damaging	Het
Prune1	A	G	3: 95,255,285	L359P	probably damaging	Het
Rab4b	A	T	7: 27,176,217	V13E	probably damaging	Het
Rbbp6	T	G	7: 122,976,008	V80G	possibly damaging	Het
Reep5	C	T	18: 34,349,800	G119S	possibly damaging	Het
Rem1	G	C	2: 152,634,665	R281P	probably damaging	Het
Rnf215	C	T	11: 4,139,989	R309C	probably damaging	Het
Scn4a	C	A	11: 106,324,632	V1173F	probably damaging	Het
Serpine3	A	T	14: 62,673,015	I186F	possibly damaging	Het
Slc7a1	A	G	5: 148,352,236	V67A	probably damaging	Het
Smco2	A	T	6: 146,860,009	E142V	possibly damaging	Het
Spata25	G	A	2: 164,827,969	P41S	probably benign	Het
Specc1l	A	G	10: 75,276,804	D955G	probably damaging	Het
Spns3	C	T	11: 72,539,034		probably null	Het
Sptbn2	C	T	19: 4,744,207	R1480C	probably damaging	Het
Taf1a	T	C	1: 183,408,434		probably null	Het
Tas2r107	G	T	6: 131,659,600	T162K	possibly damaging	Het
Tcea1	T	C	1: 4,889,551	S139P	probably benign	Het
Tecta	C	T	9: 42,330,987	V2102I	probably benign	Het
Tmem131	A	T	1: 36,872,548	I106K	probably damaging	Het
Tpbpb	A	G	13: 60,902,111	V68A	probably benign	Het
Ttc27	A	T	17: 74,718,715	N61I	probably benign	Het
Ttn	T	C	2: 76,749,677	N23624S	probably damaging	Het
Usp2	T	C	9: 44,067,222		probably null	Het
Vmn1r10	A	G	6: 57,114,041	H206R	probably benign	Het
Vmn1r234	T	C	17: 21,229,217	I131T	probably damaging	Het
Wdr36	T	C	18: 32,850,525	L443P	probably benign	Het
Zcchc6	T	C	13: 59,800,090	K806E	probably benign	Het
Zfp143	T	C	7: 110,088,818	V489A	probably benign	Het
Zfp383	G	A	7: 29,915,271	R317Q	probably damaging	Het
Zswim8	A	G	14: 20,716,300	T839A	probably damaging	Het

Other mutations in Vwf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Vwf	APN	6	125658872	missense	unknown
IGL00561:Vwf	APN	6	125642721	missense	possibly damaging	0.88
IGL01104:Vwf	APN	6	125683556	missense	probably damaging	1.00
IGL01404:Vwf	APN	6	125677970	missense	probably damaging	1.00
IGL01539:Vwf	APN	6	125590262	missense	possibly damaging	0.85
IGL01550:Vwf	APN	6	125679289	missense	probably benign	0.00
IGL01563:Vwf	APN	6	125591165	missense	probably damaging	1.00
IGL01637:Vwf	APN	6	125645736	missense	probably damaging	1.00
IGL01720:Vwf	APN	6	125642835	missense	possibly damaging	0.69
IGL01834:Vwf	APN	6	125590170	splice site	probably benign
IGL02103:Vwf	APN	6	125646355	missense	probably damaging	1.00
IGL02120:Vwf	APN	6	125616034	missense	probably benign	0.26
IGL02174:Vwf	APN	6	125555395	missense	probably damaging	1.00
IGL02203:Vwf	APN	6	125642406	missense	probably damaging	1.00
IGL02420:Vwf	APN	6	125677916	missense	probably benign	0.00
IGL02723:Vwf	APN	6	125642930	missense	possibly damaging	0.85
IGL02818:Vwf	APN	6	125663548	missense	probably benign
IGL02931:Vwf	APN	6	125615968	missense	possibly damaging	0.68
IGL03015:Vwf	APN	6	125684138	splice site	probably benign
IGL03038:Vwf	APN	6	125604157	missense	possibly damaging	0.92
IGL03060:Vwf	APN	6	125663560	missense	probably damaging	1.00
IGL03114:Vwf	APN	6	125599363	nonsense	probably null
IGL03266:Vwf	APN	6	125678077	splice site	probably benign
gingerman	UTSW	6	125662963	critical splice acceptor site	probably null
R0605_vwf_644	UTSW	6	125685837	missense	probably benign	0.02
R1575_Vwf_091	UTSW	6	125663571	nonsense	probably null
R1628_Vwf_608	UTSW	6	125647738	unclassified	probably benign
R1669_Vwf_448	UTSW	6	125647906	missense	possibly damaging	0.92
R1833_Vwf_948	UTSW	6	125642037	missense	probably benign	0.14
R2130_vwf_946	UTSW	6	125657057	missense	probably damaging	1.00
R6360_Vwf_065	UTSW	6	125683526	missense	probably benign	0.13
R7900_Vwf_938	UTSW	6	125628476	critical splice donor site	probably null
Russiahouse	UTSW	6	125639341	nonsense	probably null
B5639:Vwf	UTSW	6	125642984	missense	probably damaging	1.00
R0025:Vwf	UTSW	6	125682812	missense	probably benign	0.05
R0025:Vwf	UTSW	6	125682812	missense	probably benign	0.05
R0087:Vwf	UTSW	6	125645954	missense	probably benign	0.03
R0194:Vwf	UTSW	6	125643297	missense	probably benign
R0206:Vwf	UTSW	6	125637456	missense	probably damaging	1.00
R0233:Vwf	UTSW	6	125686510	missense	possibly damaging	0.91
R0233:Vwf	UTSW	6	125686510	missense	possibly damaging	0.91
R0390:Vwf	UTSW	6	125626361	nonsense	probably null
R0427:Vwf	UTSW	6	125673939	missense	probably benign
R0437:Vwf	UTSW	6	125566318	missense	probably damaging	1.00
R0470:Vwf	UTSW	6	125628428	missense	possibly damaging	0.70
R0499:Vwf	UTSW	6	125638114	missense	probably benign	0.10
R0554:Vwf	UTSW	6	125642781	missense	probably benign	0.13
R0605:Vwf	UTSW	6	125685837	missense	probably benign	0.02
R0711:Vwf	UTSW	6	125626271	missense	probably benign	0.01
R0723:Vwf	UTSW	6	125566262	missense	probably benign	0.01
R0973:Vwf	UTSW	6	125643006	missense	probably damaging	1.00
R1054:Vwf	UTSW	6	125590227	missense	probably damaging	1.00
R1115:Vwf	UTSW	6	125655065	missense	unknown
R1156:Vwf	UTSW	6	125637488	missense	probably damaging	1.00
R1191:Vwf	UTSW	6	125599252	missense	probably damaging	1.00
R1240:Vwf	UTSW	6	125603308	splice site	probably null
R1398:Vwf	UTSW	6	125603457	missense	probably benign	0.02
R1435:Vwf	UTSW	6	125642249	nonsense	probably null
R1528:Vwf	UTSW	6	125608291	missense	possibly damaging	0.69
R1575:Vwf	UTSW	6	125655251	missense	unknown
R1575:Vwf	UTSW	6	125663571	nonsense	probably null
R1628:Vwf	UTSW	6	125647738	unclassified	probably benign
R1669:Vwf	UTSW	6	125647906	missense	possibly damaging	0.92
R1699:Vwf	UTSW	6	125643069	missense	probably damaging	1.00
R1699:Vwf	UTSW	6	125685900	missense	possibly damaging	0.74
R1725:Vwf	UTSW	6	125646282	missense	probably benign	0.05
R1742:Vwf	UTSW	6	125667550	missense	probably benign	0.02
R1809:Vwf	UTSW	6	125590175	splice site	probably benign
R1833:Vwf	UTSW	6	125642037	missense	probably benign	0.14
R1866:Vwf	UTSW	6	125667529	missense	possibly damaging	0.62
R1870:Vwf	UTSW	6	125642939	missense	probably damaging	1.00
R1874:Vwf	UTSW	6	125628372	missense	probably benign	0.00
R1941:Vwf	UTSW	6	125639279	missense	possibly damaging	0.64
R2061:Vwf	UTSW	6	125591188	missense	probably damaging	0.98
R2103:Vwf	UTSW	6	125646330	missense	probably benign	0.31
R2104:Vwf	UTSW	6	125646330	missense	probably benign	0.31
R2130:Vwf	UTSW	6	125657057	missense	probably damaging	1.00
R2159:Vwf	UTSW	6	125626341	missense	probably damaging	0.99
R2178:Vwf	UTSW	6	125642132	missense	possibly damaging	0.90
R2656:Vwf	UTSW	6	125555361	missense	probably benign	0.00
R2913:Vwf	UTSW	6	125685846	missense	probably benign	0.08
R2917:Vwf	UTSW	6	125608143	missense	probably benign	0.07
R3726:Vwf	UTSW	6	125677948	utr 3 prime	probably benign
R3735:Vwf	UTSW	6	125588613	missense	probably damaging	1.00
R3774:Vwf	UTSW	6	125649099	splice site	probably null
R3934:Vwf	UTSW	6	125555499	missense	probably damaging	1.00
R4291:Vwf	UTSW	6	125642322	missense	probably damaging	1.00
R4384:Vwf	UTSW	6	125655116	missense	unknown
R4743:Vwf	UTSW	6	125684091	critical splice acceptor site	probably null
R4760:Vwf	UTSW	6	125570604	missense	probably damaging	1.00
R4776:Vwf	UTSW	6	125566305	missense	possibly damaging	0.53
R4791:Vwf	UTSW	6	125643363	missense
R4871:Vwf	UTSW	6	125686462	missense	probably benign	0.25
R4894:Vwf	UTSW	6	125645934	nonsense	probably null
R4963:Vwf	UTSW	6	125667483	nonsense	probably null
R5010:Vwf	UTSW	6	125566257	missense	probably benign	0.15
R5289:Vwf	UTSW	6	125667510	utr 3 prime	probably benign
R5512:Vwf	UTSW	6	125673887	utr 3 prime	probably benign
R5523:Vwf	UTSW	6	125643042	missense
R5642:Vwf	UTSW	6	125603418	missense
R5860:Vwf	UTSW	6	125643090	missense
R5860:Vwf	UTSW	6	125679265	utr 3 prime	probably benign
R5896:Vwf	UTSW	6	125678762	critical splice acceptor site	probably null
R5926:Vwf	UTSW	6	125604174	missense	probably damaging	1.00
R5976:Vwf	UTSW	6	125603463	missense
R6053:Vwf	UTSW	6	125600665	missense	probably benign	0.21
R6151:Vwf	UTSW	6	125657065	missense	unknown
R6179:Vwf	UTSW	6	125649289	missense	unknown
R6181:Vwf	UTSW	6	125566146	missense	probably damaging	0.98
R6234:Vwf	UTSW	6	125657165	missense	unknown
R6360:Vwf	UTSW	6	125683526	missense	probably benign	0.13
R6412:Vwf	UTSW	6	125679316	missense	probably benign	0.00
R6464:Vwf	UTSW	6	125639400	critical splice donor site	probably null
R6522:Vwf	UTSW	6	125662963	critical splice acceptor site	probably null
R6766:Vwf	UTSW	6	125639376	missense	unknown
R6856:Vwf	UTSW	6	125642150	nonsense	probably null
R6877:Vwf	UTSW	6	125657201	missense	possibly damaging	0.48
R6896:Vwf	UTSW	6	125566194	missense	probably damaging	1.00
R7113:Vwf	UTSW	6	125655044	missense
R7287:Vwf	UTSW	6	125637467	missense
R7359:Vwf	UTSW	6	125566257	missense
R7509:Vwf	UTSW	6	125642169	missense
R7519:Vwf	UTSW	6	125667543	missense
R7545:Vwf	UTSW	6	125614097	missense
R7549:Vwf	UTSW	6	125626267	missense
R7593:Vwf	UTSW	6	125647768	missense
R7793:Vwf	UTSW	6	125686520	missense
R7802:Vwf	UTSW	6	125666677	missense
R7824:Vwf	UTSW	6	125658815	missense
R7849:Vwf	UTSW	6	125656803	missense
R7900:Vwf	UTSW	6	125628476	critical splice donor site	probably null
R7919:Vwf	UTSW	6	125647859	missense
R7966:Vwf	UTSW	6	125639341	nonsense	probably null
R8101:Vwf	UTSW	6	125570559	nonsense	probably null
R8162:Vwf	UTSW	6	125645836	splice site	probably null
R8345:Vwf	UTSW	6	125679302	missense
R8853:Vwf	UTSW	6	125657264	missense
R9027:Vwf	UTSW	6	125666663	missense
R9065:Vwf	UTSW	6	125646299	missense
R9068:Vwf	UTSW	6	125648829	unclassified	probably benign
R9128:Vwf	UTSW	6	125642730	missense
R9136:Vwf	UTSW	6	125599393	splice site	probably benign
R9164:Vwf	UTSW	6	125565843	missense
R9177:Vwf	UTSW	6	125604291	missense
R9334:Vwf	UTSW	6	125677946	missense
R9508:Vwf	UTSW	6	125555508	missense
R9553:Vwf	UTSW	6	125600699	missense
R9660:Vwf	UTSW	6	125591707	missense	possibly damaging	0.61
R9706:Vwf	UTSW	6	125624573	missense
R9708:Vwf	UTSW	6	125657090	missense
R9712:Vwf	UTSW	6	125624573	missense
R9714:Vwf	UTSW	6	125624573	missense
R9728:Vwf	UTSW	6	125591707	missense	possibly damaging	0.61
R9758:Vwf	UTSW	6	125626267	missense
X0021:Vwf	UTSW	6	125646331	missense	probably damaging	1.00
X0065:Vwf	UTSW	6	125603433	missense	probably null	0.05
Z1176:Vwf	UTSW	6	125591231	missense
Z1176:Vwf	UTSW	6	125603308	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- CAGATGCACACAGTTGGAAG -3'
(R):5'- AAAGAGGACACCCTGTTGCC -3'

Sequencing Primer
(F):5'- CACACAGTTGGAAGGAAGAAATGTC -3'
(R):5'- GTCACCTACCCTTTCTTTAGAAAATG -3'

Posted On

2019-10-24