Incidental Mutation 'R7635:Vwf'
ID 589877
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene Name Von Willebrand factor
Synonyms B130011O06Rik, 6820430P06Rik
MMRRC Submission 045694-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R7635 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 125529911-125663642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 125659697 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 2632 (R2632L)
Ref Sequence ENSEMBL: ENSMUSP00000107873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112254]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: R2632L

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147101
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A C 9: 108,274,605 (GRCm39) D236A probably damaging Het
Adamts7 C T 9: 90,077,298 (GRCm39) P1322S probably damaging Het
AI661453 A T 17: 47,778,676 (GRCm39) T801S unknown Het
Alpk1 A G 3: 127,489,310 (GRCm39) V123A probably benign Het
Ap2b1 T C 11: 83,280,554 (GRCm39) V827A probably benign Het
Aqp5 T A 15: 99,492,059 (GRCm39) I219N probably benign Het
Astn1 G A 1: 158,495,105 (GRCm39) W1051* probably null Het
Atp8b1 T C 18: 64,706,376 (GRCm39) D211G possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,448 (GRCm39) probably benign Het
Bsn A G 9: 107,988,189 (GRCm39) V2521A unknown Het
Car7 T C 8: 105,275,069 (GRCm39) V169A probably damaging Het
Catip T A 1: 74,408,121 (GRCm39) D484E unknown Het
Ccdc18 T C 5: 108,376,915 (GRCm39) probably null Het
Cdyl T C 13: 36,055,634 (GRCm39) V518A probably damaging Het
Cep350 A T 1: 155,754,767 (GRCm39) C1949* probably null Het
Cinp A G 12: 110,850,447 (GRCm39) V18A possibly damaging Het
Clec14a A G 12: 58,315,314 (GRCm39) C103R probably damaging Het
Cplane1 A G 15: 8,256,404 (GRCm39) I1955V probably benign Het
Dnah8 G C 17: 31,004,081 (GRCm39) E3655Q probably damaging Het
Dnajc11 T C 4: 152,053,068 (GRCm39) I164T probably damaging Het
Dnajc13 A T 9: 104,039,566 (GRCm39) M2101K probably benign Het
Ephb4 A G 5: 137,370,365 (GRCm39) D864G probably damaging Het
Fads2b T A 2: 85,330,581 (GRCm39) H242L probably benign Het
Fkbp5 T C 17: 28,647,335 (GRCm39) T167A probably benign Het
Foxf2 C A 13: 31,810,087 (GRCm39) P9T unknown Het
Frmpd2 C A 14: 33,222,920 (GRCm39) H105N possibly damaging Het
Gal3st3 C A 19: 5,357,434 (GRCm39) R270S probably damaging Het
Galnt13 A G 2: 54,747,829 (GRCm39) I237V probably damaging Het
Gata5 G T 2: 179,975,790 (GRCm39) Q125K possibly damaging Het
Gm10036 T A 18: 15,966,346 (GRCm39) F166I possibly damaging Het
Gon4l A G 3: 88,802,413 (GRCm39) N1008S probably benign Het
Got1l1 G A 8: 27,687,962 (GRCm39) L356F probably damaging Het
Gse1 A G 8: 121,299,634 (GRCm39) E888G unknown Het
Hmx1 C A 5: 35,549,583 (GRCm39) P292Q possibly damaging Het
Igkv7-33 A T 6: 70,036,138 (GRCm39) S16T probably benign Het
Itga2b C T 11: 102,352,582 (GRCm39) G424D probably damaging Het
Itga6 A T 2: 71,673,577 (GRCm39) K870N probably benign Het
Lama4 A T 10: 38,968,184 (GRCm39) Q1442L probably benign Het
Lamc1 C T 1: 153,124,806 (GRCm39) R655H probably damaging Het
Lclat1 C T 17: 73,468,931 (GRCm39) S37L probably benign Het
Lrp1b A G 2: 41,013,609 (GRCm39) probably null Het
Map3k20 T C 2: 72,232,348 (GRCm39) S335P probably benign Het
Micu3 A G 8: 40,819,275 (GRCm39) D318G possibly damaging Het
Mmp16 T C 4: 18,054,382 (GRCm39) I296T probably benign Het
Mmp20 A T 9: 7,639,335 (GRCm39) I168L probably benign Het
Mpp3 T C 11: 101,916,209 (GRCm39) K48E probably damaging Het
Muc5ac A T 7: 141,359,413 (GRCm39) D1291V probably damaging Het
Muc5ac A T 7: 141,359,490 (GRCm39) T1317S possibly damaging Het
Myl10 A T 5: 136,729,718 (GRCm39) M119L probably benign Het
Myo5b T A 18: 74,713,467 (GRCm39) V104E probably damaging Het
Nek10 G A 14: 14,850,932 (GRCm38) V326M probably benign Het
Or11l3 T A 11: 58,515,990 (GRCm39) E107D unknown Het
Or6c2 A T 10: 129,362,551 (GRCm39) M152L probably benign Het
Or6z1 G A 7: 6,504,581 (GRCm39) L221F probably benign Het
Pcnx1 A G 12: 81,965,899 (GRCm39) T161A Het
Peg10 T C 6: 4,754,938 (GRCm39) S240P probably damaging Het
Pex6 G A 17: 47,034,943 (GRCm39) V822M probably damaging Het
Pla2r1 T A 2: 60,365,106 (GRCm39) T155S probably benign Het
Pld5 A T 1: 175,821,416 (GRCm39) probably null Het
Plxna4 A G 6: 32,473,676 (GRCm39) V447A probably damaging Het
Pou2af1 T C 9: 51,144,283 (GRCm39) S66P probably benign Het
Pramel26 T C 4: 143,536,987 (GRCm39) E448G probably damaging Het
Prl2c2 T C 13: 13,171,928 (GRCm39) D147G probably damaging Het
Prune1 A G 3: 95,162,596 (GRCm39) L359P probably damaging Het
Rab4b A T 7: 26,875,642 (GRCm39) V13E probably damaging Het
Rbbp6 T G 7: 122,575,231 (GRCm39) V80G possibly damaging Het
Reep5 C T 18: 34,482,853 (GRCm39) G119S possibly damaging Het
Rem1 G C 2: 152,476,585 (GRCm39) R281P probably damaging Het
Rnf215 C T 11: 4,089,989 (GRCm39) R309C probably damaging Het
Scn4a C A 11: 106,215,458 (GRCm39) V1173F probably damaging Het
Serpine3 A T 14: 62,910,464 (GRCm39) I186F possibly damaging Het
Slc7a1 A G 5: 148,289,046 (GRCm39) V67A probably damaging Het
Smco2 A T 6: 146,761,507 (GRCm39) E142V possibly damaging Het
Spata25 G A 2: 164,669,889 (GRCm39) P41S probably benign Het
Specc1l A G 10: 75,112,638 (GRCm39) D955G probably damaging Het
Spns3 C T 11: 72,429,860 (GRCm39) probably null Het
Sptbn2 C T 19: 4,794,235 (GRCm39) R1480C probably damaging Het
Taf1a T C 1: 183,189,253 (GRCm39) probably null Het
Tas2r107 G T 6: 131,636,563 (GRCm39) T162K possibly damaging Het
Tcea1 T C 1: 4,959,774 (GRCm39) S139P probably benign Het
Tecta C T 9: 42,242,283 (GRCm39) V2102I probably benign Het
Tmem131 A T 1: 36,911,629 (GRCm39) I106K probably damaging Het
Tpbpb A G 13: 61,049,925 (GRCm39) V68A probably benign Het
Ttc27 A T 17: 75,025,710 (GRCm39) N61I probably benign Het
Ttn T C 2: 76,580,021 (GRCm39) N23624S probably damaging Het
Tut7 T C 13: 59,947,904 (GRCm39) K806E probably benign Het
Usp2 T C 9: 43,978,519 (GRCm39) probably null Het
Vmn1r10 A G 6: 57,091,026 (GRCm39) H206R probably benign Het
Vmn1r234 T C 17: 21,449,479 (GRCm39) I131T probably damaging Het
Wdr36 T C 18: 32,983,578 (GRCm39) L443P probably benign Het
Zfp143 T C 7: 109,688,025 (GRCm39) V489A probably benign Het
Zfp383 G A 7: 29,614,696 (GRCm39) R317Q probably damaging Het
Zswim8 A G 14: 20,766,368 (GRCm39) T839A probably damaging Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125,635,835 (GRCm39) missense unknown
IGL00561:Vwf APN 6 125,619,684 (GRCm39) missense possibly damaging 0.88
IGL01104:Vwf APN 6 125,660,519 (GRCm39) missense probably damaging 1.00
IGL01404:Vwf APN 6 125,654,933 (GRCm39) missense probably damaging 1.00
IGL01539:Vwf APN 6 125,567,225 (GRCm39) missense possibly damaging 0.85
IGL01550:Vwf APN 6 125,656,252 (GRCm39) missense probably benign 0.00
IGL01563:Vwf APN 6 125,568,128 (GRCm39) missense probably damaging 1.00
IGL01637:Vwf APN 6 125,622,699 (GRCm39) missense probably damaging 1.00
IGL01720:Vwf APN 6 125,619,798 (GRCm39) missense possibly damaging 0.69
IGL01834:Vwf APN 6 125,567,133 (GRCm39) splice site probably benign
IGL02103:Vwf APN 6 125,623,318 (GRCm39) missense probably damaging 1.00
IGL02120:Vwf APN 6 125,592,997 (GRCm39) missense probably benign 0.26
IGL02174:Vwf APN 6 125,532,358 (GRCm39) missense probably damaging 1.00
IGL02203:Vwf APN 6 125,619,369 (GRCm39) missense probably damaging 1.00
IGL02420:Vwf APN 6 125,654,879 (GRCm39) missense probably benign 0.00
IGL02723:Vwf APN 6 125,619,893 (GRCm39) missense possibly damaging 0.85
IGL02818:Vwf APN 6 125,640,511 (GRCm39) missense probably benign
IGL02931:Vwf APN 6 125,592,931 (GRCm39) missense possibly damaging 0.68
IGL03015:Vwf APN 6 125,661,101 (GRCm39) splice site probably benign
IGL03038:Vwf APN 6 125,581,120 (GRCm39) missense possibly damaging 0.92
IGL03060:Vwf APN 6 125,640,523 (GRCm39) missense probably damaging 1.00
IGL03114:Vwf APN 6 125,576,326 (GRCm39) nonsense probably null
IGL03266:Vwf APN 6 125,655,040 (GRCm39) splice site probably benign
gingerman UTSW 6 125,639,926 (GRCm39) critical splice acceptor site probably null
R0605_vwf_644 UTSW 6 125,662,800 (GRCm39) missense probably benign 0.02
R1575_Vwf_091 UTSW 6 125,640,534 (GRCm39) nonsense probably null
R1628_Vwf_608 UTSW 6 125,624,701 (GRCm39) unclassified probably benign
R1669_Vwf_448 UTSW 6 125,624,869 (GRCm39) missense possibly damaging 0.92
R1833_Vwf_948 UTSW 6 125,619,000 (GRCm39) missense probably benign 0.14
R2130_vwf_946 UTSW 6 125,634,020 (GRCm39) missense probably damaging 1.00
R6360_Vwf_065 UTSW 6 125,660,489 (GRCm39) missense probably benign 0.13
R7900_Vwf_938 UTSW 6 125,605,439 (GRCm39) critical splice donor site probably null
Russiahouse UTSW 6 125,616,304 (GRCm39) nonsense probably null
B5639:Vwf UTSW 6 125,619,947 (GRCm39) missense probably damaging 1.00
R0025:Vwf UTSW 6 125,659,775 (GRCm39) missense probably benign 0.05
R0025:Vwf UTSW 6 125,659,775 (GRCm39) missense probably benign 0.05
R0087:Vwf UTSW 6 125,622,917 (GRCm39) missense probably benign 0.03
R0194:Vwf UTSW 6 125,620,260 (GRCm39) missense probably benign
R0206:Vwf UTSW 6 125,614,419 (GRCm39) missense probably damaging 1.00
R0233:Vwf UTSW 6 125,663,473 (GRCm39) missense possibly damaging 0.91
R0233:Vwf UTSW 6 125,663,473 (GRCm39) missense possibly damaging 0.91
R0390:Vwf UTSW 6 125,603,324 (GRCm39) nonsense probably null
R0427:Vwf UTSW 6 125,650,902 (GRCm39) missense probably benign
R0437:Vwf UTSW 6 125,543,281 (GRCm39) missense probably damaging 1.00
R0470:Vwf UTSW 6 125,605,391 (GRCm39) missense possibly damaging 0.70
R0499:Vwf UTSW 6 125,615,077 (GRCm39) missense probably benign 0.10
R0554:Vwf UTSW 6 125,619,744 (GRCm39) missense probably benign 0.13
R0605:Vwf UTSW 6 125,662,800 (GRCm39) missense probably benign 0.02
R0711:Vwf UTSW 6 125,603,234 (GRCm39) missense probably benign 0.01
R0723:Vwf UTSW 6 125,543,225 (GRCm39) missense probably benign 0.01
R0973:Vwf UTSW 6 125,619,969 (GRCm39) missense probably damaging 1.00
R1054:Vwf UTSW 6 125,567,190 (GRCm39) missense probably damaging 1.00
R1115:Vwf UTSW 6 125,632,028 (GRCm39) missense unknown
R1156:Vwf UTSW 6 125,614,451 (GRCm39) missense probably damaging 1.00
R1191:Vwf UTSW 6 125,576,215 (GRCm39) missense probably damaging 1.00
R1240:Vwf UTSW 6 125,580,271 (GRCm39) splice site probably null
R1398:Vwf UTSW 6 125,580,420 (GRCm39) missense probably benign 0.02
R1435:Vwf UTSW 6 125,619,212 (GRCm39) nonsense probably null
R1528:Vwf UTSW 6 125,585,254 (GRCm39) missense possibly damaging 0.69
R1575:Vwf UTSW 6 125,640,534 (GRCm39) nonsense probably null
R1575:Vwf UTSW 6 125,632,214 (GRCm39) missense unknown
R1628:Vwf UTSW 6 125,624,701 (GRCm39) unclassified probably benign
R1669:Vwf UTSW 6 125,624,869 (GRCm39) missense possibly damaging 0.92
R1699:Vwf UTSW 6 125,662,863 (GRCm39) missense possibly damaging 0.74
R1699:Vwf UTSW 6 125,620,032 (GRCm39) missense probably damaging 1.00
R1725:Vwf UTSW 6 125,623,245 (GRCm39) missense probably benign 0.05
R1742:Vwf UTSW 6 125,644,513 (GRCm39) missense probably benign 0.02
R1809:Vwf UTSW 6 125,567,138 (GRCm39) splice site probably benign
R1833:Vwf UTSW 6 125,619,000 (GRCm39) missense probably benign 0.14
R1866:Vwf UTSW 6 125,644,492 (GRCm39) missense possibly damaging 0.62
R1870:Vwf UTSW 6 125,619,902 (GRCm39) missense probably damaging 1.00
R1874:Vwf UTSW 6 125,605,335 (GRCm39) missense probably benign 0.00
R1941:Vwf UTSW 6 125,616,242 (GRCm39) missense possibly damaging 0.64
R2061:Vwf UTSW 6 125,568,151 (GRCm39) missense probably damaging 0.98
R2103:Vwf UTSW 6 125,623,293 (GRCm39) missense probably benign 0.31
R2104:Vwf UTSW 6 125,623,293 (GRCm39) missense probably benign 0.31
R2130:Vwf UTSW 6 125,634,020 (GRCm39) missense probably damaging 1.00
R2159:Vwf UTSW 6 125,603,304 (GRCm39) missense probably damaging 0.99
R2178:Vwf UTSW 6 125,619,095 (GRCm39) missense possibly damaging 0.90
R2656:Vwf UTSW 6 125,532,324 (GRCm39) missense probably benign 0.00
R2913:Vwf UTSW 6 125,662,809 (GRCm39) missense probably benign 0.08
R2917:Vwf UTSW 6 125,585,106 (GRCm39) missense probably benign 0.07
R3726:Vwf UTSW 6 125,654,911 (GRCm39) utr 3 prime probably benign
R3735:Vwf UTSW 6 125,565,576 (GRCm39) missense probably damaging 1.00
R3774:Vwf UTSW 6 125,626,062 (GRCm39) splice site probably null
R3934:Vwf UTSW 6 125,532,462 (GRCm39) missense probably damaging 1.00
R4291:Vwf UTSW 6 125,619,285 (GRCm39) missense probably damaging 1.00
R4384:Vwf UTSW 6 125,632,079 (GRCm39) missense unknown
R4743:Vwf UTSW 6 125,661,054 (GRCm39) critical splice acceptor site probably null
R4760:Vwf UTSW 6 125,547,567 (GRCm39) missense probably damaging 1.00
R4776:Vwf UTSW 6 125,543,268 (GRCm39) missense possibly damaging 0.53
R4791:Vwf UTSW 6 125,620,326 (GRCm39) missense
R4871:Vwf UTSW 6 125,663,425 (GRCm39) missense probably benign 0.25
R4894:Vwf UTSW 6 125,622,897 (GRCm39) nonsense probably null
R4963:Vwf UTSW 6 125,644,446 (GRCm39) nonsense probably null
R5010:Vwf UTSW 6 125,543,220 (GRCm39) missense probably benign 0.15
R5289:Vwf UTSW 6 125,644,473 (GRCm39) utr 3 prime probably benign
R5512:Vwf UTSW 6 125,650,850 (GRCm39) utr 3 prime probably benign
R5523:Vwf UTSW 6 125,620,005 (GRCm39) missense
R5642:Vwf UTSW 6 125,580,381 (GRCm39) missense
R5860:Vwf UTSW 6 125,656,228 (GRCm39) utr 3 prime probably benign
R5860:Vwf UTSW 6 125,620,053 (GRCm39) missense
R5896:Vwf UTSW 6 125,655,725 (GRCm39) critical splice acceptor site probably null
R5926:Vwf UTSW 6 125,581,137 (GRCm39) missense probably damaging 1.00
R5976:Vwf UTSW 6 125,580,426 (GRCm39) missense
R6053:Vwf UTSW 6 125,577,628 (GRCm39) missense probably benign 0.21
R6151:Vwf UTSW 6 125,634,028 (GRCm39) missense unknown
R6179:Vwf UTSW 6 125,626,252 (GRCm39) missense unknown
R6181:Vwf UTSW 6 125,543,109 (GRCm39) missense probably damaging 0.98
R6234:Vwf UTSW 6 125,634,128 (GRCm39) missense unknown
R6360:Vwf UTSW 6 125,660,489 (GRCm39) missense probably benign 0.13
R6412:Vwf UTSW 6 125,656,279 (GRCm39) missense probably benign 0.00
R6464:Vwf UTSW 6 125,616,363 (GRCm39) critical splice donor site probably null
R6522:Vwf UTSW 6 125,639,926 (GRCm39) critical splice acceptor site probably null
R6766:Vwf UTSW 6 125,616,339 (GRCm39) missense unknown
R6856:Vwf UTSW 6 125,619,113 (GRCm39) nonsense probably null
R6877:Vwf UTSW 6 125,634,164 (GRCm39) missense possibly damaging 0.48
R6896:Vwf UTSW 6 125,543,157 (GRCm39) missense probably damaging 1.00
R7113:Vwf UTSW 6 125,632,007 (GRCm39) missense
R7287:Vwf UTSW 6 125,614,430 (GRCm39) missense
R7359:Vwf UTSW 6 125,543,220 (GRCm39) missense
R7509:Vwf UTSW 6 125,619,132 (GRCm39) missense
R7519:Vwf UTSW 6 125,644,506 (GRCm39) missense
R7545:Vwf UTSW 6 125,591,060 (GRCm39) missense
R7549:Vwf UTSW 6 125,603,230 (GRCm39) missense
R7593:Vwf UTSW 6 125,624,731 (GRCm39) missense
R7793:Vwf UTSW 6 125,663,483 (GRCm39) missense
R7802:Vwf UTSW 6 125,643,640 (GRCm39) missense
R7824:Vwf UTSW 6 125,635,778 (GRCm39) missense
R7849:Vwf UTSW 6 125,633,766 (GRCm39) missense
R7900:Vwf UTSW 6 125,605,439 (GRCm39) critical splice donor site probably null
R7919:Vwf UTSW 6 125,624,822 (GRCm39) missense
R7966:Vwf UTSW 6 125,616,304 (GRCm39) nonsense probably null
R8101:Vwf UTSW 6 125,547,522 (GRCm39) nonsense probably null
R8162:Vwf UTSW 6 125,622,799 (GRCm39) splice site probably null
R8345:Vwf UTSW 6 125,656,265 (GRCm39) missense
R8853:Vwf UTSW 6 125,634,227 (GRCm39) missense
R9027:Vwf UTSW 6 125,643,626 (GRCm39) missense
R9065:Vwf UTSW 6 125,623,262 (GRCm39) missense
R9068:Vwf UTSW 6 125,625,792 (GRCm39) unclassified probably benign
R9128:Vwf UTSW 6 125,619,693 (GRCm39) missense
R9136:Vwf UTSW 6 125,576,356 (GRCm39) splice site probably benign
R9164:Vwf UTSW 6 125,542,806 (GRCm39) missense
R9177:Vwf UTSW 6 125,581,254 (GRCm39) missense
R9334:Vwf UTSW 6 125,654,909 (GRCm39) missense
R9508:Vwf UTSW 6 125,532,471 (GRCm39) missense
R9553:Vwf UTSW 6 125,577,662 (GRCm39) missense
R9660:Vwf UTSW 6 125,568,670 (GRCm39) missense possibly damaging 0.61
R9706:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9708:Vwf UTSW 6 125,634,053 (GRCm39) missense
R9712:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9714:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9728:Vwf UTSW 6 125,568,670 (GRCm39) missense possibly damaging 0.61
R9758:Vwf UTSW 6 125,603,230 (GRCm39) missense
X0021:Vwf UTSW 6 125,623,294 (GRCm39) missense probably damaging 1.00
X0065:Vwf UTSW 6 125,580,396 (GRCm39) missense probably null 0.05
Z1176:Vwf UTSW 6 125,580,271 (GRCm39) splice site probably null
Z1176:Vwf UTSW 6 125,568,194 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CAGATGCACACAGTTGGAAG -3'
(R):5'- AAAGAGGACACCCTGTTGCC -3'

Sequencing Primer
(F):5'- CACACAGTTGGAAGGAAGAAATGTC -3'
(R):5'- GTCACCTACCCTTTCTTTAGAAAATG -3'
Posted On 2019-10-24