Incidental Mutation 'R7635:Car7'
ID589889
Institutional Source Beutler Lab
Gene Symbol Car7
Ensembl Gene ENSMUSG00000031883
Gene Namecarbonic anhydrase 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7635 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location104534689-104550343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104548437 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 169 (V169A)
Ref Sequence ENSEMBL: ENSMUSP00000052136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056051] [ENSMUST00000159416] [ENSMUST00000162761]
Predicted Effect probably damaging
Transcript: ENSMUST00000056051
AA Change: V169A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052136
Gene: ENSMUSG00000031883
AA Change: V169A

DomainStartEndE-ValueType
Carb_anhydrase 7 262 7.17e-144 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159416
AA Change: V113A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125112
Gene: ENSMUSG00000031883
AA Change: V113A

DomainStartEndE-ValueType
Carb_anhydrase 1 206 1.93e-94 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162761
AA Change: V113A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125404
Gene: ENSMUSG00000031883
AA Change: V113A

DomainStartEndE-ValueType
Carb_anhydrase 1 206 1.93e-94 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. The cytosolic protein encoded by this gene is predominantly expressed in the salivary glands. Alternative splicing in the coding region results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced and atypical experimental febrile seizures with the absence of electrographic seizures and abnormal GABA-mediated receptor currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A C 9: 108,397,406 D236A probably damaging Het
2410089E03Rik A G 15: 8,226,920 I1955V probably benign Het
4833423E24Rik T A 2: 85,500,237 H242L probably benign Het
Adamts7 C T 9: 90,195,245 P1322S probably damaging Het
AI661453 A T 17: 47,467,751 T801S unknown Het
Alpk1 A G 3: 127,695,661 V123A probably benign Het
Ap2b1 T C 11: 83,389,728 V827A probably benign Het
Aqp5 T A 15: 99,594,178 I219N probably benign Het
Astn1 G A 1: 158,667,535 W1051* probably null Het
Atp8b1 T C 18: 64,573,305 D211G possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
Bsn A G 9: 108,110,990 V2521A unknown Het
Catip T A 1: 74,368,962 D484E unknown Het
Ccdc18 T C 5: 108,229,049 probably null Het
Cdyl T C 13: 35,871,651 V518A probably damaging Het
Cep350 A T 1: 155,879,021 C1949* probably null Het
Cinp A G 12: 110,884,013 V18A possibly damaging Het
Clec14a A G 12: 58,268,528 C103R probably damaging Het
Dnah8 G C 17: 30,785,107 E3655Q probably damaging Het
Dnajc11 T C 4: 151,968,611 I164T probably damaging Het
Dnajc13 A T 9: 104,162,367 M2101K probably benign Het
Ephb4 A G 5: 137,372,103 D864G probably damaging Het
Fkbp5 T C 17: 28,428,361 T167A probably benign Het
Foxf2 C A 13: 31,626,104 P9T unknown Het
Frmpd2 C A 14: 33,500,963 H105N possibly damaging Het
Gal3st3 C A 19: 5,307,406 R270S probably damaging Het
Galnt13 A G 2: 54,857,817 I237V probably damaging Het
Gata5 G T 2: 180,333,997 Q125K possibly damaging Het
Gm10036 T A 18: 15,833,289 F166I possibly damaging Het
Gm13084 T C 4: 143,810,417 E448G probably damaging Het
Gon4l A G 3: 88,895,106 N1008S probably benign Het
Got1l1 G A 8: 27,197,934 L356F probably damaging Het
Gse1 A G 8: 120,572,895 E888G unknown Het
Hmx1 C A 5: 35,392,239 P292Q possibly damaging Het
Igkv7-33 A T 6: 70,059,154 S16T probably benign Het
Itga2b C T 11: 102,461,756 G424D probably damaging Het
Itga6 A T 2: 71,843,233 K870N probably benign Het
Lama4 A T 10: 39,092,188 Q1442L probably benign Het
Lamc1 C T 1: 153,249,060 R655H probably damaging Het
Lclat1 C T 17: 73,161,936 S37L probably benign Het
Lrp1b A G 2: 41,123,597 probably null Het
Map3k20 T C 2: 72,402,004 S335P probably benign Het
Micu3 A G 8: 40,366,234 D318G possibly damaging Het
Mmp16 T C 4: 18,054,382 I296T probably benign Het
Mmp20 A T 9: 7,639,334 I168L probably benign Het
Mpp3 T C 11: 102,025,383 K48E probably damaging Het
Muc5ac A T 7: 141,805,676 D1291V probably damaging Het
Muc5ac A T 7: 141,805,753 T1317S possibly damaging Het
Myl10 A T 5: 136,700,864 M119L probably benign Het
Myo5b T A 18: 74,580,396 V104E probably damaging Het
Nek10 G A 14: 14,850,932 V326M probably benign Het
Olfr1348 G A 7: 6,501,582 L221F probably benign Het
Olfr323 T A 11: 58,625,164 E107D unknown Het
Olfr791 A T 10: 129,526,682 M152L probably benign Het
Pcnx A G 12: 81,919,125 T161A Het
Peg10 T C 6: 4,754,938 S240P probably damaging Het
Pex6 G A 17: 46,724,017 V822M probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Pld5 A T 1: 175,993,850 probably null Het
Plxna4 A G 6: 32,496,741 V447A probably damaging Het
Pou2af1 T C 9: 51,232,983 S66P probably benign Het
Prl2c2 T C 13: 12,997,343 D147G probably damaging Het
Prune1 A G 3: 95,255,285 L359P probably damaging Het
Rab4b A T 7: 27,176,217 V13E probably damaging Het
Rbbp6 T G 7: 122,976,008 V80G possibly damaging Het
Reep5 C T 18: 34,349,800 G119S possibly damaging Het
Rem1 G C 2: 152,634,665 R281P probably damaging Het
Rnf215 C T 11: 4,139,989 R309C probably damaging Het
Scn4a C A 11: 106,324,632 V1173F probably damaging Het
Serpine3 A T 14: 62,673,015 I186F possibly damaging Het
Slc7a1 A G 5: 148,352,236 V67A probably damaging Het
Smco2 A T 6: 146,860,009 E142V possibly damaging Het
Spata25 G A 2: 164,827,969 P41S probably benign Het
Specc1l A G 10: 75,276,804 D955G probably damaging Het
Spns3 C T 11: 72,539,034 probably null Het
Sptbn2 C T 19: 4,744,207 R1480C probably damaging Het
Taf1a T C 1: 183,408,434 probably null Het
Tas2r107 G T 6: 131,659,600 T162K possibly damaging Het
Tcea1 T C 1: 4,889,551 S139P probably benign Het
Tecta C T 9: 42,330,987 V2102I probably benign Het
Tmem131 A T 1: 36,872,548 I106K probably damaging Het
Tpbpb A G 13: 60,902,111 V68A probably benign Het
Ttc27 A T 17: 74,718,715 N61I probably benign Het
Ttn T C 2: 76,749,677 N23624S probably damaging Het
Usp2 T C 9: 44,067,222 probably null Het
Vmn1r10 A G 6: 57,114,041 H206R probably benign Het
Vmn1r234 T C 17: 21,229,217 I131T probably damaging Het
Vwf G T 6: 125,682,734 R2632L Het
Wdr36 T C 18: 32,850,525 L443P probably benign Het
Zcchc6 T C 13: 59,800,090 K806E probably benign Het
Zfp143 T C 7: 110,088,818 V489A probably benign Het
Zfp383 G A 7: 29,915,271 R317Q probably damaging Het
Zswim8 A G 14: 20,716,300 T839A probably damaging Het
Other mutations in Car7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Car7 APN 8 104549548 splice site probably null
IGL02306:Car7 APN 8 104548998 missense probably damaging 1.00
IGL02936:Car7 APN 8 104548222 missense possibly damaging 0.82
IGL03125:Car7 APN 8 104548219 missense probably benign 0.00
R0409:Car7 UTSW 8 104548424 missense probably damaging 1.00
R0485:Car7 UTSW 8 104543538 missense probably benign 0.00
R1981:Car7 UTSW 8 104548377 splice site probably benign
R2129:Car7 UTSW 8 104548973 missense possibly damaging 0.91
R6964:Car7 UTSW 8 104543581 missense possibly damaging 0.85
R7483:Car7 UTSW 8 104549584 missense probably benign 0.12
X0020:Car7 UTSW 8 104549003 missense probably damaging 1.00
Z1176:Car7 UTSW 8 104548959 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGTACAGCACTTTTGGGGAGG -3'
(R):5'- TGAAGAAGGCCAGGTCCATG -3'

Sequencing Primer
(F):5'- CCTGATGGCCTGGCTGTG -3'
(R):5'- TCCATGGCCTGAGGAACCAG -3'
Posted On2019-10-24