Incidental Mutation 'R7635:Adamts7'
ID589895
Institutional Source Beutler Lab
Gene Symbol Adamts7
Ensembl Gene ENSMUSG00000032363
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 7
SynonymsADAM-TS7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R7635 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location90163069-90208071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 90195245 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1322 (P1322S)
Ref Sequence ENSEMBL: ENSMUSP00000115972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113059] [ENSMUST00000113060] [ENSMUST00000134996] [ENSMUST00000147250] [ENSMUST00000167122]
Predicted Effect probably damaging
Transcript: ENSMUST00000113059
AA Change: P1423S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108682
Gene: ENSMUSG00000032363
AA Change: P1423S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 174 1.1e-36 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.3e-16 PFAM
Pfam:Reprolysin_4 224 425 8.5e-9 PFAM
Pfam:Reprolysin 226 437 2.2e-27 PFAM
Pfam:Reprolysin_2 244 427 2.9e-12 PFAM
Pfam:Reprolysin_3 248 383 5.2e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 2.2e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113060
AA Change: P1381S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108683
Gene: ENSMUSG00000032363
AA Change: P1381S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 3.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.6e-16 PFAM
Pfam:Reprolysin_4 224 425 8.2e-9 PFAM
Pfam:Reprolysin 226 437 6.4e-30 PFAM
Pfam:Reprolysin_2 244 427 4.6e-12 PFAM
Pfam:Reprolysin_3 248 383 8.1e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.5e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
low complexity region 969 983 N/A INTRINSIC
low complexity region 1169 1191 N/A INTRINSIC
TSP1 1343 1393 2.4e-2 SMART
TSP1 1394 1451 1.8e-2 SMART
TSP1 1453 1500 4.82e-2 SMART
TSP1 1501 1558 1.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134996
SMART Domains Protein: ENSMUSP00000119744
Gene: ENSMUSG00000032363

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 2.4e-29 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 412 1e-17 PFAM
Pfam:Reprolysin_4 224 426 5e-10 PFAM
Pfam:Reprolysin 226 437 3.7e-31 PFAM
Pfam:Reprolysin_2 244 427 3.2e-13 PFAM
Pfam:Reprolysin_3 248 383 6.3e-14 PFAM
Blast:ACR 439 505 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000147250
AA Change: P1322S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115972
Gene: ENSMUSG00000032363
AA Change: P1322S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 2.7e-26 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.4e-14 PFAM
Pfam:Reprolysin_4 224 425 7e-7 PFAM
Pfam:Reprolysin 226 437 4.9e-28 PFAM
Pfam:Reprolysin_2 244 427 5e-10 PFAM
Pfam:Reprolysin_3 248 383 6.5e-11 PFAM
ACR 439 515 1.7e-5 SMART
TSP1 526 578 2.3e-15 SMART
Pfam:ADAM_spacer1 683 794 3.5e-34 PFAM
TSP1 807 863 6.9e-9 SMART
TSP1 866 908 1.2e-3 SMART
low complexity region 969 983 N/A INTRINSIC
low complexity region 1169 1191 N/A INTRINSIC
TSP1 1284 1334 1.2e-4 SMART
TSP1 1335 1392 8.7e-5 SMART
TSP1 1394 1441 2.3e-4 SMART
TSP1 1442 1499 6.5e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167122
AA Change: P1423S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129292
Gene: ENSMUSG00000032363
AA Change: P1423S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 1.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 7.2e-17 PFAM
Pfam:Reprolysin_4 224 425 3.6e-9 PFAM
Pfam:Reprolysin 226 437 2.9e-30 PFAM
Pfam:Reprolysin_2 244 427 2.2e-12 PFAM
Pfam:Reprolysin_3 248 383 3.7e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.1e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent enzyme that degrades cartilage oligomeric matrix protein. The deficiency of the encoded protein decreases atherosclerosis in genetically hyperlipidemic mice and in response to vascular injury. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for a null allele show increased lung function parameters, reduced endothelial cell migration and proliferation, increased re-endothelialization and ameliorated neointima formation after carotid artery injury, and increased oval cell activation and biliary fibrosis after liver injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A C 9: 108,397,406 D236A probably damaging Het
2410089E03Rik A G 15: 8,226,920 I1955V probably benign Het
4833423E24Rik T A 2: 85,500,237 H242L probably benign Het
AI661453 A T 17: 47,467,751 T801S unknown Het
Alpk1 A G 3: 127,695,661 V123A probably benign Het
Ap2b1 T C 11: 83,389,728 V827A probably benign Het
Aqp5 T A 15: 99,594,178 I219N probably benign Het
Astn1 G A 1: 158,667,535 W1051* probably null Het
Atp8b1 T C 18: 64,573,305 D211G possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
Bsn A G 9: 108,110,990 V2521A unknown Het
Car7 T C 8: 104,548,437 V169A probably damaging Het
Catip T A 1: 74,368,962 D484E unknown Het
Ccdc18 T C 5: 108,229,049 probably null Het
Cdyl T C 13: 35,871,651 V518A probably damaging Het
Cep350 A T 1: 155,879,021 C1949* probably null Het
Cinp A G 12: 110,884,013 V18A possibly damaging Het
Clec14a A G 12: 58,268,528 C103R probably damaging Het
Dnah8 G C 17: 30,785,107 E3655Q probably damaging Het
Dnajc11 T C 4: 151,968,611 I164T probably damaging Het
Dnajc13 A T 9: 104,162,367 M2101K probably benign Het
Ephb4 A G 5: 137,372,103 D864G probably damaging Het
Fkbp5 T C 17: 28,428,361 T167A probably benign Het
Foxf2 C A 13: 31,626,104 P9T unknown Het
Frmpd2 C A 14: 33,500,963 H105N possibly damaging Het
Gal3st3 C A 19: 5,307,406 R270S probably damaging Het
Galnt13 A G 2: 54,857,817 I237V probably damaging Het
Gata5 G T 2: 180,333,997 Q125K possibly damaging Het
Gm10036 T A 18: 15,833,289 F166I possibly damaging Het
Gm13084 T C 4: 143,810,417 E448G probably damaging Het
Gon4l A G 3: 88,895,106 N1008S probably benign Het
Got1l1 G A 8: 27,197,934 L356F probably damaging Het
Gse1 A G 8: 120,572,895 E888G unknown Het
Hmx1 C A 5: 35,392,239 P292Q possibly damaging Het
Igkv7-33 A T 6: 70,059,154 S16T probably benign Het
Itga2b C T 11: 102,461,756 G424D probably damaging Het
Itga6 A T 2: 71,843,233 K870N probably benign Het
Lama4 A T 10: 39,092,188 Q1442L probably benign Het
Lamc1 C T 1: 153,249,060 R655H probably damaging Het
Lclat1 C T 17: 73,161,936 S37L probably benign Het
Lrp1b A G 2: 41,123,597 probably null Het
Map3k20 T C 2: 72,402,004 S335P probably benign Het
Micu3 A G 8: 40,366,234 D318G possibly damaging Het
Mmp16 T C 4: 18,054,382 I296T probably benign Het
Mmp20 A T 9: 7,639,334 I168L probably benign Het
Mpp3 T C 11: 102,025,383 K48E probably damaging Het
Muc5ac A T 7: 141,805,676 D1291V probably damaging Het
Muc5ac A T 7: 141,805,753 T1317S possibly damaging Het
Myl10 A T 5: 136,700,864 M119L probably benign Het
Myo5b T A 18: 74,580,396 V104E probably damaging Het
Nek10 G A 14: 14,850,932 V326M probably benign Het
Olfr1348 G A 7: 6,501,582 L221F probably benign Het
Olfr323 T A 11: 58,625,164 E107D unknown Het
Olfr791 A T 10: 129,526,682 M152L probably benign Het
Pcnx A G 12: 81,919,125 T161A Het
Peg10 T C 6: 4,754,938 S240P probably damaging Het
Pex6 G A 17: 46,724,017 V822M probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Pld5 A T 1: 175,993,850 probably null Het
Plxna4 A G 6: 32,496,741 V447A probably damaging Het
Pou2af1 T C 9: 51,232,983 S66P probably benign Het
Prl2c2 T C 13: 12,997,343 D147G probably damaging Het
Prune1 A G 3: 95,255,285 L359P probably damaging Het
Rab4b A T 7: 27,176,217 V13E probably damaging Het
Rbbp6 T G 7: 122,976,008 V80G possibly damaging Het
Reep5 C T 18: 34,349,800 G119S possibly damaging Het
Rem1 G C 2: 152,634,665 R281P probably damaging Het
Rnf215 C T 11: 4,139,989 R309C probably damaging Het
Scn4a C A 11: 106,324,632 V1173F probably damaging Het
Serpine3 A T 14: 62,673,015 I186F possibly damaging Het
Slc7a1 A G 5: 148,352,236 V67A probably damaging Het
Smco2 A T 6: 146,860,009 E142V possibly damaging Het
Spata25 G A 2: 164,827,969 P41S probably benign Het
Specc1l A G 10: 75,276,804 D955G probably damaging Het
Spns3 C T 11: 72,539,034 probably null Het
Sptbn2 C T 19: 4,744,207 R1480C probably damaging Het
Taf1a T C 1: 183,408,434 probably null Het
Tas2r107 G T 6: 131,659,600 T162K possibly damaging Het
Tcea1 T C 1: 4,889,551 S139P probably benign Het
Tecta C T 9: 42,330,987 V2102I probably benign Het
Tmem131 A T 1: 36,872,548 I106K probably damaging Het
Tpbpb A G 13: 60,902,111 V68A probably benign Het
Ttc27 A T 17: 74,718,715 N61I probably benign Het
Ttn T C 2: 76,749,677 N23624S probably damaging Het
Usp2 T C 9: 44,067,222 probably null Het
Vmn1r10 A G 6: 57,114,041 H206R probably benign Het
Vmn1r234 T C 17: 21,229,217 I131T probably damaging Het
Vwf G T 6: 125,682,734 R2632L Het
Wdr36 T C 18: 32,850,525 L443P probably benign Het
Zcchc6 T C 13: 59,800,090 K806E probably benign Het
Zfp143 T C 7: 110,088,818 V489A probably benign Het
Zfp383 G A 7: 29,915,271 R317Q probably damaging Het
Zswim8 A G 14: 20,716,300 T839A probably damaging Het
Other mutations in Adamts7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Adamts7 APN 9 90194249 missense possibly damaging 0.71
IGL00673:Adamts7 APN 9 90193661 missense possibly damaging 0.78
IGL00902:Adamts7 APN 9 90188794 critical splice donor site probably null
IGL01303:Adamts7 APN 9 90171734 missense possibly damaging 0.46
IGL01333:Adamts7 APN 9 90186979 missense probably damaging 1.00
IGL01431:Adamts7 APN 9 90207785 missense possibly damaging 0.89
IGL01595:Adamts7 APN 9 90193306 missense probably benign 0.02
IGL02728:Adamts7 APN 9 90191827 splice site probably benign
IGL02860:Adamts7 APN 9 90191862 missense probably benign
IGL03237:Adamts7 APN 9 90188664 missense probably damaging 1.00
PIT4495001:Adamts7 UTSW 9 90174622 missense probably damaging 1.00
R0044:Adamts7 UTSW 9 90171588 missense possibly damaging 0.58
R0078:Adamts7 UTSW 9 90179411 missense probably damaging 1.00
R0107:Adamts7 UTSW 9 90180720 missense possibly damaging 0.82
R0122:Adamts7 UTSW 9 90179421 missense probably damaging 1.00
R0166:Adamts7 UTSW 9 90193692 missense probably benign 0.00
R0517:Adamts7 UTSW 9 90199858 missense probably benign 0.01
R1442:Adamts7 UTSW 9 90188770 missense probably damaging 0.99
R1468:Adamts7 UTSW 9 90188798 splice site probably benign
R1554:Adamts7 UTSW 9 90173650 missense probably damaging 1.00
R1612:Adamts7 UTSW 9 90188697 missense possibly damaging 0.86
R1652:Adamts7 UTSW 9 90189644 missense probably damaging 1.00
R2007:Adamts7 UTSW 9 90177856 missense probably damaging 1.00
R2091:Adamts7 UTSW 9 90188440 critical splice donor site probably null
R2202:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2204:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2205:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2305:Adamts7 UTSW 9 90180711 missense probably benign 0.39
R2409:Adamts7 UTSW 9 90180687 missense probably damaging 1.00
R4157:Adamts7 UTSW 9 90188361 missense probably damaging 1.00
R4210:Adamts7 UTSW 9 90194010 missense possibly damaging 0.95
R4368:Adamts7 UTSW 9 90195851 critical splice donor site probably null
R4533:Adamts7 UTSW 9 90180708 missense probably damaging 1.00
R4608:Adamts7 UTSW 9 90174540 missense probably damaging 1.00
R4623:Adamts7 UTSW 9 90186462 missense probably benign 0.17
R4661:Adamts7 UTSW 9 90193330 missense probably benign 0.02
R4820:Adamts7 UTSW 9 90189686 missense possibly damaging 0.62
R4942:Adamts7 UTSW 9 90163311 missense probably benign
R4961:Adamts7 UTSW 9 90185740 missense probably damaging 1.00
R5064:Adamts7 UTSW 9 90195830 missense probably damaging 1.00
R5763:Adamts7 UTSW 9 90188409 missense probably damaging 1.00
R5921:Adamts7 UTSW 9 90188694 missense probably benign 0.20
R6027:Adamts7 UTSW 9 90191025 missense probably damaging 1.00
R6182:Adamts7 UTSW 9 90192436 missense probably benign 0.01
R6306:Adamts7 UTSW 9 90178278 critical splice donor site probably null
R6404:Adamts7 UTSW 9 90180456 intron probably null
R6488:Adamts7 UTSW 9 90171482 missense probably benign 0.00
R6649:Adamts7 UTSW 9 90191937 missense probably damaging 1.00
R6658:Adamts7 UTSW 9 90195300 missense probably damaging 0.99
R6874:Adamts7 UTSW 9 90188731 missense probably damaging 1.00
R6947:Adamts7 UTSW 9 90191804 intron probably null
R7110:Adamts7 UTSW 9 90193964 missense possibly damaging 0.92
R7224:Adamts7 UTSW 9 90185815 missense probably damaging 1.00
R7239:Adamts7 UTSW 9 90186557 splice site probably null
R7519:Adamts7 UTSW 9 90197079 missense probably benign 0.22
R7608:Adamts7 UTSW 9 90173773 missense possibly damaging 0.68
X0028:Adamts7 UTSW 9 90178217 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TTCACAGTCTTCTCGGGAGGTG -3'
(R):5'- GCCATGCTGAATGAAGATCTCC -3'

Sequencing Primer
(F):5'- GGGGAGGAGTCTGTCTTGCAG -3'
(R):5'- CCATGCTGAATGAAGATCTCCAAGAG -3'
Posted On2019-10-24