Incidental Mutation 'R7635:Or11l3'
ID 589903
Institutional Source Beutler Lab
Gene Symbol Or11l3
Ensembl Gene ENSMUSG00000043880
Gene Name olfactory receptor family 11 subfamily L member 3
Synonyms MOR107-1, Olfr323, GA_x6K02T2NKPP-794386-795357
MMRRC Submission 045694-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R7635 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 58515899-58516870 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58515990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 107 (E107D)
Ref Sequence ENSEMBL: ENSMUSP00000145459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070804] [ENSMUST00000203173] [ENSMUST00000214132]
AlphaFold Q5NCD0
Predicted Effect probably damaging
Transcript: ENSMUST00000070804
AA Change: N294I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068147
Gene: ENSMUSG00000043880
AA Change: N294I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-54 PFAM
Pfam:7tm_1 41 290 3.7e-21 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000203173
AA Change: E107D
SMART Domains Protein: ENSMUSP00000145459
Gene: ENSMUSG00000043880
AA Change: E107D

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214132
AA Change: N294I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A C 9: 108,274,605 (GRCm39) D236A probably damaging Het
Adamts7 C T 9: 90,077,298 (GRCm39) P1322S probably damaging Het
AI661453 A T 17: 47,778,676 (GRCm39) T801S unknown Het
Alpk1 A G 3: 127,489,310 (GRCm39) V123A probably benign Het
Ap2b1 T C 11: 83,280,554 (GRCm39) V827A probably benign Het
Aqp5 T A 15: 99,492,059 (GRCm39) I219N probably benign Het
Astn1 G A 1: 158,495,105 (GRCm39) W1051* probably null Het
Atp8b1 T C 18: 64,706,376 (GRCm39) D211G possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,448 (GRCm39) probably benign Het
Bsn A G 9: 107,988,189 (GRCm39) V2521A unknown Het
Car7 T C 8: 105,275,069 (GRCm39) V169A probably damaging Het
Catip T A 1: 74,408,121 (GRCm39) D484E unknown Het
Ccdc18 T C 5: 108,376,915 (GRCm39) probably null Het
Cdyl T C 13: 36,055,634 (GRCm39) V518A probably damaging Het
Cep350 A T 1: 155,754,767 (GRCm39) C1949* probably null Het
Cinp A G 12: 110,850,447 (GRCm39) V18A possibly damaging Het
Clec14a A G 12: 58,315,314 (GRCm39) C103R probably damaging Het
Cplane1 A G 15: 8,256,404 (GRCm39) I1955V probably benign Het
Dnah8 G C 17: 31,004,081 (GRCm39) E3655Q probably damaging Het
Dnajc11 T C 4: 152,053,068 (GRCm39) I164T probably damaging Het
Dnajc13 A T 9: 104,039,566 (GRCm39) M2101K probably benign Het
Ephb4 A G 5: 137,370,365 (GRCm39) D864G probably damaging Het
Fads2b T A 2: 85,330,581 (GRCm39) H242L probably benign Het
Fkbp5 T C 17: 28,647,335 (GRCm39) T167A probably benign Het
Foxf2 C A 13: 31,810,087 (GRCm39) P9T unknown Het
Frmpd2 C A 14: 33,222,920 (GRCm39) H105N possibly damaging Het
Gal3st3 C A 19: 5,357,434 (GRCm39) R270S probably damaging Het
Galnt13 A G 2: 54,747,829 (GRCm39) I237V probably damaging Het
Gata5 G T 2: 179,975,790 (GRCm39) Q125K possibly damaging Het
Gm10036 T A 18: 15,966,346 (GRCm39) F166I possibly damaging Het
Gon4l A G 3: 88,802,413 (GRCm39) N1008S probably benign Het
Got1l1 G A 8: 27,687,962 (GRCm39) L356F probably damaging Het
Gse1 A G 8: 121,299,634 (GRCm39) E888G unknown Het
Hmx1 C A 5: 35,549,583 (GRCm39) P292Q possibly damaging Het
Igkv7-33 A T 6: 70,036,138 (GRCm39) S16T probably benign Het
Itga2b C T 11: 102,352,582 (GRCm39) G424D probably damaging Het
Itga6 A T 2: 71,673,577 (GRCm39) K870N probably benign Het
Lama4 A T 10: 38,968,184 (GRCm39) Q1442L probably benign Het
Lamc1 C T 1: 153,124,806 (GRCm39) R655H probably damaging Het
Lclat1 C T 17: 73,468,931 (GRCm39) S37L probably benign Het
Lrp1b A G 2: 41,013,609 (GRCm39) probably null Het
Map3k20 T C 2: 72,232,348 (GRCm39) S335P probably benign Het
Micu3 A G 8: 40,819,275 (GRCm39) D318G possibly damaging Het
Mmp16 T C 4: 18,054,382 (GRCm39) I296T probably benign Het
Mmp20 A T 9: 7,639,335 (GRCm39) I168L probably benign Het
Mpp3 T C 11: 101,916,209 (GRCm39) K48E probably damaging Het
Muc5ac A T 7: 141,359,413 (GRCm39) D1291V probably damaging Het
Muc5ac A T 7: 141,359,490 (GRCm39) T1317S possibly damaging Het
Myl10 A T 5: 136,729,718 (GRCm39) M119L probably benign Het
Myo5b T A 18: 74,713,467 (GRCm39) V104E probably damaging Het
Nek10 G A 14: 14,850,932 (GRCm38) V326M probably benign Het
Or6c2 A T 10: 129,362,551 (GRCm39) M152L probably benign Het
Or6z1 G A 7: 6,504,581 (GRCm39) L221F probably benign Het
Pcnx1 A G 12: 81,965,899 (GRCm39) T161A Het
Peg10 T C 6: 4,754,938 (GRCm39) S240P probably damaging Het
Pex6 G A 17: 47,034,943 (GRCm39) V822M probably damaging Het
Pla2r1 T A 2: 60,365,106 (GRCm39) T155S probably benign Het
Pld5 A T 1: 175,821,416 (GRCm39) probably null Het
Plxna4 A G 6: 32,473,676 (GRCm39) V447A probably damaging Het
Pou2af1 T C 9: 51,144,283 (GRCm39) S66P probably benign Het
Pramel26 T C 4: 143,536,987 (GRCm39) E448G probably damaging Het
Prl2c2 T C 13: 13,171,928 (GRCm39) D147G probably damaging Het
Prune1 A G 3: 95,162,596 (GRCm39) L359P probably damaging Het
Rab4b A T 7: 26,875,642 (GRCm39) V13E probably damaging Het
Rbbp6 T G 7: 122,575,231 (GRCm39) V80G possibly damaging Het
Reep5 C T 18: 34,482,853 (GRCm39) G119S possibly damaging Het
Rem1 G C 2: 152,476,585 (GRCm39) R281P probably damaging Het
Rnf215 C T 11: 4,089,989 (GRCm39) R309C probably damaging Het
Scn4a C A 11: 106,215,458 (GRCm39) V1173F probably damaging Het
Serpine3 A T 14: 62,910,464 (GRCm39) I186F possibly damaging Het
Slc7a1 A G 5: 148,289,046 (GRCm39) V67A probably damaging Het
Smco2 A T 6: 146,761,507 (GRCm39) E142V possibly damaging Het
Spata25 G A 2: 164,669,889 (GRCm39) P41S probably benign Het
Specc1l A G 10: 75,112,638 (GRCm39) D955G probably damaging Het
Spns3 C T 11: 72,429,860 (GRCm39) probably null Het
Sptbn2 C T 19: 4,794,235 (GRCm39) R1480C probably damaging Het
Taf1a T C 1: 183,189,253 (GRCm39) probably null Het
Tas2r107 G T 6: 131,636,563 (GRCm39) T162K possibly damaging Het
Tcea1 T C 1: 4,959,774 (GRCm39) S139P probably benign Het
Tecta C T 9: 42,242,283 (GRCm39) V2102I probably benign Het
Tmem131 A T 1: 36,911,629 (GRCm39) I106K probably damaging Het
Tpbpb A G 13: 61,049,925 (GRCm39) V68A probably benign Het
Ttc27 A T 17: 75,025,710 (GRCm39) N61I probably benign Het
Ttn T C 2: 76,580,021 (GRCm39) N23624S probably damaging Het
Tut7 T C 13: 59,947,904 (GRCm39) K806E probably benign Het
Usp2 T C 9: 43,978,519 (GRCm39) probably null Het
Vmn1r10 A G 6: 57,091,026 (GRCm39) H206R probably benign Het
Vmn1r234 T C 17: 21,449,479 (GRCm39) I131T probably damaging Het
Vwf G T 6: 125,659,697 (GRCm39) R2632L Het
Wdr36 T C 18: 32,983,578 (GRCm39) L443P probably benign Het
Zfp143 T C 7: 109,688,025 (GRCm39) V489A probably benign Het
Zfp383 G A 7: 29,614,696 (GRCm39) R317Q probably damaging Het
Zswim8 A G 14: 20,766,368 (GRCm39) T839A probably damaging Het
Other mutations in Or11l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02995:Or11l3 APN 11 58,516,107 (GRCm39) missense possibly damaging 0.92
IGL03118:Or11l3 APN 11 58,516,269 (GRCm39) missense probably damaging 0.99
R0058:Or11l3 UTSW 11 58,516,494 (GRCm39) missense probably damaging 1.00
R0335:Or11l3 UTSW 11 58,516,566 (GRCm39) missense probably damaging 1.00
R1127:Or11l3 UTSW 11 58,516,284 (GRCm39) missense probably damaging 0.98
R2029:Or11l3 UTSW 11 58,516,319 (GRCm39) missense probably damaging 1.00
R2434:Or11l3 UTSW 11 58,515,937 (GRCm39) missense possibly damaging 0.95
R5483:Or11l3 UTSW 11 58,516,783 (GRCm39) missense possibly damaging 0.95
R6423:Or11l3 UTSW 11 58,516,189 (GRCm39) missense probably damaging 1.00
R6990:Or11l3 UTSW 11 58,516,284 (GRCm39) missense probably damaging 0.98
R7472:Or11l3 UTSW 11 58,516,260 (GRCm39) missense probably damaging 1.00
R7539:Or11l3 UTSW 11 58,516,782 (GRCm39) missense probably damaging 1.00
R7647:Or11l3 UTSW 11 58,516,029 (GRCm39) missense probably damaging 1.00
R8519:Or11l3 UTSW 11 58,516,800 (GRCm39) missense probably damaging 1.00
R8869:Or11l3 UTSW 11 58,515,994 (GRCm39) missense unknown
R9180:Or11l3 UTSW 11 58,516,062 (GRCm39) missense probably benign 0.36
R9262:Or11l3 UTSW 11 58,516,282 (GRCm39) missense probably benign 0.00
R9788:Or11l3 UTSW 11 58,516,692 (GRCm39) missense probably benign 0.03
Z1186:Or11l3 UTSW 11 58,516,588 (GRCm39) missense probably benign 0.00
Z1186:Or11l3 UTSW 11 58,516,619 (GRCm39) missense probably benign
Z1186:Or11l3 UTSW 11 58,516,732 (GRCm39) missense possibly damaging 0.87
Z1186:Or11l3 UTSW 11 58,516,130 (GRCm39) missense probably benign 0.16
Z1186:Or11l3 UTSW 11 58,516,075 (GRCm39) missense probably benign 0.16
Z1187:Or11l3 UTSW 11 58,516,619 (GRCm39) missense probably benign
Z1187:Or11l3 UTSW 11 58,516,732 (GRCm39) missense possibly damaging 0.87
Z1187:Or11l3 UTSW 11 58,516,075 (GRCm39) missense probably benign 0.16
Z1187:Or11l3 UTSW 11 58,516,130 (GRCm39) missense probably benign 0.16
Z1187:Or11l3 UTSW 11 58,516,588 (GRCm39) missense probably benign 0.00
Z1188:Or11l3 UTSW 11 58,516,588 (GRCm39) missense probably benign 0.00
Z1188:Or11l3 UTSW 11 58,516,130 (GRCm39) missense probably benign 0.16
Z1188:Or11l3 UTSW 11 58,516,075 (GRCm39) missense probably benign 0.16
Z1188:Or11l3 UTSW 11 58,516,732 (GRCm39) missense possibly damaging 0.87
Z1188:Or11l3 UTSW 11 58,516,619 (GRCm39) missense probably benign
Z1189:Or11l3 UTSW 11 58,516,588 (GRCm39) missense probably benign 0.00
Z1189:Or11l3 UTSW 11 58,516,130 (GRCm39) missense probably benign 0.16
Z1189:Or11l3 UTSW 11 58,516,075 (GRCm39) missense probably benign 0.16
Z1189:Or11l3 UTSW 11 58,516,732 (GRCm39) missense possibly damaging 0.87
Z1189:Or11l3 UTSW 11 58,516,619 (GRCm39) missense probably benign
Z1190:Or11l3 UTSW 11 58,516,588 (GRCm39) missense probably benign 0.00
Z1190:Or11l3 UTSW 11 58,516,130 (GRCm39) missense probably benign 0.16
Z1190:Or11l3 UTSW 11 58,516,075 (GRCm39) missense probably benign 0.16
Z1190:Or11l3 UTSW 11 58,516,732 (GRCm39) missense possibly damaging 0.87
Z1190:Or11l3 UTSW 11 58,516,619 (GRCm39) missense probably benign
Z1191:Or11l3 UTSW 11 58,516,588 (GRCm39) missense probably benign 0.00
Z1191:Or11l3 UTSW 11 58,516,130 (GRCm39) missense probably benign 0.16
Z1191:Or11l3 UTSW 11 58,516,075 (GRCm39) missense probably benign 0.16
Z1191:Or11l3 UTSW 11 58,516,732 (GRCm39) missense possibly damaging 0.87
Z1191:Or11l3 UTSW 11 58,516,619 (GRCm39) missense probably benign
Z1192:Or11l3 UTSW 11 58,516,588 (GRCm39) missense probably benign 0.00
Z1192:Or11l3 UTSW 11 58,516,130 (GRCm39) missense probably benign 0.16
Z1192:Or11l3 UTSW 11 58,516,075 (GRCm39) missense probably benign 0.16
Z1192:Or11l3 UTSW 11 58,516,732 (GRCm39) missense possibly damaging 0.87
Z1192:Or11l3 UTSW 11 58,516,619 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAAGGCCAGCTTAGCAGTG -3'
(R):5'- GTGTCCTCCATTCTGAGAATCC -3'

Sequencing Primer
(F):5'- CCAGCTTAGCAGTGCTTTAGAG -3'
(R):5'- CGGCAGGATGAAGACGTTTTCTAC -3'
Posted On 2019-10-24