Incidental Mutation 'R7635:Ap2b1'
ID 589905
Institutional Source Beutler Lab
Gene Symbol Ap2b1
Ensembl Gene ENSMUSG00000035152
Gene Name adaptor-related protein complex 2, beta 1 subunit
Synonyms 1300012O03Rik
MMRRC Submission 045694-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7635 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 83189850-83295861 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83280554 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 827 (V827A)
Ref Sequence ENSEMBL: ENSMUSP00000018875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523]
AlphaFold Q9DBG3
Predicted Effect probably benign
Transcript: ENSMUST00000018875
AA Change: V827A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: V827A

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 2.6e-173 PFAM
Pfam:HEAT_2 88 157 3.7e-8 PFAM
Pfam:Cnd1 99 268 2.1e-40 PFAM
Pfam:HEAT_2 124 219 1.4e-9 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 950 9.93e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065692
AA Change: V813A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: V813A

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4.2e-173 PFAM
Pfam:HEAT_2 88 157 2.7e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Alpha_adaptinC2 707 817 2.94e-18 SMART
B2-adapt-app_C 826 936 9.93e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176430
AA Change: V827A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: V827A

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4e-173 PFAM
Pfam:HEAT_2 88 157 2.8e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 936 7.22e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176523
AA Change: V789A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: V789A

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 95 1.1e-26 PFAM
Pfam:Cnd1 69 230 1.5e-26 PFAM
Pfam:HEAT_2 85 182 5.1e-9 PFAM
Pfam:Adaptin_N 90 496 4e-125 PFAM
low complexity region 587 605 N/A INTRINSIC
low complexity region 616 637 N/A INTRINSIC
Alpha_adaptinC2 683 793 2.94e-18 SMART
B2-adapt-app_C 802 912 9.93e-56 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A C 9: 108,274,605 (GRCm39) D236A probably damaging Het
Adamts7 C T 9: 90,077,298 (GRCm39) P1322S probably damaging Het
AI661453 A T 17: 47,778,676 (GRCm39) T801S unknown Het
Alpk1 A G 3: 127,489,310 (GRCm39) V123A probably benign Het
Aqp5 T A 15: 99,492,059 (GRCm39) I219N probably benign Het
Astn1 G A 1: 158,495,105 (GRCm39) W1051* probably null Het
Atp8b1 T C 18: 64,706,376 (GRCm39) D211G possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,448 (GRCm39) probably benign Het
Bsn A G 9: 107,988,189 (GRCm39) V2521A unknown Het
Car7 T C 8: 105,275,069 (GRCm39) V169A probably damaging Het
Catip T A 1: 74,408,121 (GRCm39) D484E unknown Het
Ccdc18 T C 5: 108,376,915 (GRCm39) probably null Het
Cdyl T C 13: 36,055,634 (GRCm39) V518A probably damaging Het
Cep350 A T 1: 155,754,767 (GRCm39) C1949* probably null Het
Cinp A G 12: 110,850,447 (GRCm39) V18A possibly damaging Het
Clec14a A G 12: 58,315,314 (GRCm39) C103R probably damaging Het
Cplane1 A G 15: 8,256,404 (GRCm39) I1955V probably benign Het
Dnah8 G C 17: 31,004,081 (GRCm39) E3655Q probably damaging Het
Dnajc11 T C 4: 152,053,068 (GRCm39) I164T probably damaging Het
Dnajc13 A T 9: 104,039,566 (GRCm39) M2101K probably benign Het
Ephb4 A G 5: 137,370,365 (GRCm39) D864G probably damaging Het
Fads2b T A 2: 85,330,581 (GRCm39) H242L probably benign Het
Fkbp5 T C 17: 28,647,335 (GRCm39) T167A probably benign Het
Foxf2 C A 13: 31,810,087 (GRCm39) P9T unknown Het
Frmpd2 C A 14: 33,222,920 (GRCm39) H105N possibly damaging Het
Gal3st3 C A 19: 5,357,434 (GRCm39) R270S probably damaging Het
Galnt13 A G 2: 54,747,829 (GRCm39) I237V probably damaging Het
Gata5 G T 2: 179,975,790 (GRCm39) Q125K possibly damaging Het
Gm10036 T A 18: 15,966,346 (GRCm39) F166I possibly damaging Het
Gon4l A G 3: 88,802,413 (GRCm39) N1008S probably benign Het
Got1l1 G A 8: 27,687,962 (GRCm39) L356F probably damaging Het
Gse1 A G 8: 121,299,634 (GRCm39) E888G unknown Het
Hmx1 C A 5: 35,549,583 (GRCm39) P292Q possibly damaging Het
Igkv7-33 A T 6: 70,036,138 (GRCm39) S16T probably benign Het
Itga2b C T 11: 102,352,582 (GRCm39) G424D probably damaging Het
Itga6 A T 2: 71,673,577 (GRCm39) K870N probably benign Het
Lama4 A T 10: 38,968,184 (GRCm39) Q1442L probably benign Het
Lamc1 C T 1: 153,124,806 (GRCm39) R655H probably damaging Het
Lclat1 C T 17: 73,468,931 (GRCm39) S37L probably benign Het
Lrp1b A G 2: 41,013,609 (GRCm39) probably null Het
Map3k20 T C 2: 72,232,348 (GRCm39) S335P probably benign Het
Micu3 A G 8: 40,819,275 (GRCm39) D318G possibly damaging Het
Mmp16 T C 4: 18,054,382 (GRCm39) I296T probably benign Het
Mmp20 A T 9: 7,639,335 (GRCm39) I168L probably benign Het
Mpp3 T C 11: 101,916,209 (GRCm39) K48E probably damaging Het
Muc5ac A T 7: 141,359,490 (GRCm39) T1317S possibly damaging Het
Muc5ac A T 7: 141,359,413 (GRCm39) D1291V probably damaging Het
Myl10 A T 5: 136,729,718 (GRCm39) M119L probably benign Het
Myo5b T A 18: 74,713,467 (GRCm39) V104E probably damaging Het
Nek10 G A 14: 14,850,932 (GRCm38) V326M probably benign Het
Or11l3 T A 11: 58,515,990 (GRCm39) E107D unknown Het
Or6c2 A T 10: 129,362,551 (GRCm39) M152L probably benign Het
Or6z1 G A 7: 6,504,581 (GRCm39) L221F probably benign Het
Pcnx1 A G 12: 81,965,899 (GRCm39) T161A Het
Peg10 T C 6: 4,754,938 (GRCm39) S240P probably damaging Het
Pex6 G A 17: 47,034,943 (GRCm39) V822M probably damaging Het
Pla2r1 T A 2: 60,365,106 (GRCm39) T155S probably benign Het
Pld5 A T 1: 175,821,416 (GRCm39) probably null Het
Plxna4 A G 6: 32,473,676 (GRCm39) V447A probably damaging Het
Pou2af1 T C 9: 51,144,283 (GRCm39) S66P probably benign Het
Pramel26 T C 4: 143,536,987 (GRCm39) E448G probably damaging Het
Prl2c2 T C 13: 13,171,928 (GRCm39) D147G probably damaging Het
Prune1 A G 3: 95,162,596 (GRCm39) L359P probably damaging Het
Rab4b A T 7: 26,875,642 (GRCm39) V13E probably damaging Het
Rbbp6 T G 7: 122,575,231 (GRCm39) V80G possibly damaging Het
Reep5 C T 18: 34,482,853 (GRCm39) G119S possibly damaging Het
Rem1 G C 2: 152,476,585 (GRCm39) R281P probably damaging Het
Rnf215 C T 11: 4,089,989 (GRCm39) R309C probably damaging Het
Scn4a C A 11: 106,215,458 (GRCm39) V1173F probably damaging Het
Serpine3 A T 14: 62,910,464 (GRCm39) I186F possibly damaging Het
Slc7a1 A G 5: 148,289,046 (GRCm39) V67A probably damaging Het
Smco2 A T 6: 146,761,507 (GRCm39) E142V possibly damaging Het
Spata25 G A 2: 164,669,889 (GRCm39) P41S probably benign Het
Specc1l A G 10: 75,112,638 (GRCm39) D955G probably damaging Het
Spns3 C T 11: 72,429,860 (GRCm39) probably null Het
Sptbn2 C T 19: 4,794,235 (GRCm39) R1480C probably damaging Het
Taf1a T C 1: 183,189,253 (GRCm39) probably null Het
Tas2r107 G T 6: 131,636,563 (GRCm39) T162K possibly damaging Het
Tcea1 T C 1: 4,959,774 (GRCm39) S139P probably benign Het
Tecta C T 9: 42,242,283 (GRCm39) V2102I probably benign Het
Tmem131 A T 1: 36,911,629 (GRCm39) I106K probably damaging Het
Tpbpb A G 13: 61,049,925 (GRCm39) V68A probably benign Het
Ttc27 A T 17: 75,025,710 (GRCm39) N61I probably benign Het
Ttn T C 2: 76,580,021 (GRCm39) N23624S probably damaging Het
Tut7 T C 13: 59,947,904 (GRCm39) K806E probably benign Het
Usp2 T C 9: 43,978,519 (GRCm39) probably null Het
Vmn1r10 A G 6: 57,091,026 (GRCm39) H206R probably benign Het
Vmn1r234 T C 17: 21,449,479 (GRCm39) I131T probably damaging Het
Vwf G T 6: 125,659,697 (GRCm39) R2632L Het
Wdr36 T C 18: 32,983,578 (GRCm39) L443P probably benign Het
Zfp143 T C 7: 109,688,025 (GRCm39) V489A probably benign Het
Zfp383 G A 7: 29,614,696 (GRCm39) R317Q probably damaging Het
Zswim8 A G 14: 20,766,368 (GRCm39) T839A probably damaging Het
Other mutations in Ap2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Ap2b1 APN 11 83,223,984 (GRCm39) missense probably damaging 0.99
IGL01583:Ap2b1 APN 11 83,215,437 (GRCm39) missense possibly damaging 0.61
IGL01753:Ap2b1 APN 11 83,212,799 (GRCm39) missense probably damaging 1.00
IGL01992:Ap2b1 APN 11 83,226,356 (GRCm39) missense probably damaging 1.00
IGL02192:Ap2b1 APN 11 83,237,592 (GRCm39) missense possibly damaging 0.48
IGL02315:Ap2b1 APN 11 83,227,625 (GRCm39) missense probably damaging 0.96
IGL03235:Ap2b1 APN 11 83,232,210 (GRCm39) missense probably benign 0.41
P0045:Ap2b1 UTSW 11 83,258,852 (GRCm39) missense probably damaging 1.00
R0121:Ap2b1 UTSW 11 83,212,793 (GRCm39) missense possibly damaging 0.66
R0334:Ap2b1 UTSW 11 83,258,700 (GRCm39) splice site probably benign
R1222:Ap2b1 UTSW 11 83,237,564 (GRCm39) missense probably benign 0.06
R1297:Ap2b1 UTSW 11 83,223,935 (GRCm39) missense probably damaging 1.00
R1653:Ap2b1 UTSW 11 83,237,657 (GRCm39) missense probably damaging 1.00
R1719:Ap2b1 UTSW 11 83,215,430 (GRCm39) missense probably damaging 1.00
R1885:Ap2b1 UTSW 11 83,281,561 (GRCm39) missense probably damaging 0.99
R1886:Ap2b1 UTSW 11 83,281,561 (GRCm39) missense probably damaging 0.99
R1965:Ap2b1 UTSW 11 83,237,721 (GRCm39) missense probably benign 0.00
R1966:Ap2b1 UTSW 11 83,237,721 (GRCm39) missense probably benign 0.00
R2046:Ap2b1 UTSW 11 83,227,212 (GRCm39) missense probably benign 0.14
R2086:Ap2b1 UTSW 11 83,241,944 (GRCm39) missense possibly damaging 0.88
R2132:Ap2b1 UTSW 11 83,215,587 (GRCm39) splice site probably benign
R3615:Ap2b1 UTSW 11 83,215,391 (GRCm39) missense possibly damaging 0.84
R3616:Ap2b1 UTSW 11 83,215,391 (GRCm39) missense possibly damaging 0.84
R3983:Ap2b1 UTSW 11 83,281,542 (GRCm39) missense probably damaging 1.00
R4124:Ap2b1 UTSW 11 83,256,471 (GRCm39) critical splice acceptor site probably null
R4125:Ap2b1 UTSW 11 83,256,471 (GRCm39) critical splice acceptor site probably null
R4198:Ap2b1 UTSW 11 83,233,429 (GRCm39) missense probably damaging 1.00
R4202:Ap2b1 UTSW 11 83,226,430 (GRCm39) critical splice donor site probably null
R4543:Ap2b1 UTSW 11 83,215,476 (GRCm39) missense probably damaging 1.00
R4583:Ap2b1 UTSW 11 83,288,605 (GRCm39) missense probably benign 0.00
R4589:Ap2b1 UTSW 11 83,223,837 (GRCm39) nonsense probably null
R4916:Ap2b1 UTSW 11 83,281,532 (GRCm39) missense probably damaging 1.00
R5005:Ap2b1 UTSW 11 83,230,218 (GRCm39) missense probably damaging 1.00
R5385:Ap2b1 UTSW 11 83,233,427 (GRCm39) missense probably damaging 1.00
R5510:Ap2b1 UTSW 11 83,227,563 (GRCm39) splice site probably null
R5738:Ap2b1 UTSW 11 83,227,256 (GRCm39) splice site probably null
R6023:Ap2b1 UTSW 11 83,226,224 (GRCm39) missense probably damaging 0.99
R6269:Ap2b1 UTSW 11 83,237,499 (GRCm39) missense probably damaging 1.00
R6383:Ap2b1 UTSW 11 83,237,651 (GRCm39) missense probably damaging 1.00
R6416:Ap2b1 UTSW 11 83,199,065 (GRCm39) start codon destroyed probably null 1.00
R6502:Ap2b1 UTSW 11 83,233,505 (GRCm39) missense probably damaging 0.97
R6810:Ap2b1 UTSW 11 83,226,317 (GRCm39) missense possibly damaging 0.89
R6969:Ap2b1 UTSW 11 83,280,552 (GRCm39) missense probably damaging 0.99
R7238:Ap2b1 UTSW 11 83,223,948 (GRCm39) missense possibly damaging 0.91
R7241:Ap2b1 UTSW 11 83,241,931 (GRCm39) missense probably benign 0.16
R7429:Ap2b1 UTSW 11 83,258,824 (GRCm39) missense probably benign 0.00
R7588:Ap2b1 UTSW 11 83,215,348 (GRCm39) missense probably benign 0.00
R7651:Ap2b1 UTSW 11 83,230,256 (GRCm39) critical splice donor site probably null
R7753:Ap2b1 UTSW 11 83,258,733 (GRCm39) nonsense probably null
R8468:Ap2b1 UTSW 11 83,241,891 (GRCm39) missense probably damaging 1.00
R8943:Ap2b1 UTSW 11 83,237,579 (GRCm39) missense probably damaging 1.00
R9093:Ap2b1 UTSW 11 83,215,395 (GRCm39) missense probably damaging 1.00
R9621:Ap2b1 UTSW 11 83,293,424 (GRCm39) missense probably damaging 1.00
X0064:Ap2b1 UTSW 11 83,215,395 (GRCm39) missense probably damaging 1.00
Z1177:Ap2b1 UTSW 11 83,256,579 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCTGGAGGGTATACCATAGTC -3'
(R):5'- AGTGACTGGCAAATGACCAATG -3'

Sequencing Primer
(F):5'- CTGGAGGGTATACCATAGTCTTCTAG -3'
(R):5'- CCAATGATCAACTACTTATTGGGGC -3'
Posted On 2019-10-24