Incidental Mutation 'R0055:Runx1'
ID58992
Institutional Source Beutler Lab
Gene Symbol Runx1
Ensembl Gene ENSMUSG00000022952
Gene Namerunt related transcription factor 1
SynonymsAML1, Pebp2a2, Cbfa2, runt domain, alpha subunit 2
MMRRC Submission 038349-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0055 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location92601466-92826149 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 92644141 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023673] [ENSMUST00000113956] [ENSMUST00000168195]
Predicted Effect probably benign
Transcript: ENSMUST00000023673
SMART Domains Protein: ENSMUSP00000023673
Gene: ENSMUSG00000022952

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
Pfam:Runt 65 194 4.5e-75 PFAM
low complexity region 205 220 N/A INTRINSIC
PDB:1B8X|A 333 374 2e-7 PDB
Pfam:RunxI 375 465 1.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113956
SMART Domains Protein: ENSMUSP00000109589
Gene: ENSMUSG00000022952

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
Pfam:Runt 48 182 3.1e-81 PFAM
low complexity region 270 283 N/A INTRINSIC
Pfam:RunxI 294 387 4.9e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168195
SMART Domains Protein: ENSMUSP00000131079
Gene: ENSMUSG00000022952

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
Pfam:Runt 48 182 4.7e-82 PFAM
low complexity region 191 206 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
Pfam:RunxI 358 451 6.4e-43 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Core binding factor (CBF) is a heterodimeric transcription factor that binds to the core element of many enhancers and promoters. The protein encoded by this gene represents the alpha subunit of CBF and is thought to be involved in the development of normal hematopoiesis. Chromosomal translocations involving this gene are well-documented and have been associated with several types of leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations affect hematopoiesis, and in some cases result in defective angiogenesis and intraventricular hemorrhage. Null homozygotes die by embryonic day 12.5; heterozygotes have reduced erythroid and myeloid progenitor numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,968,161 S108R probably damaging Het
2010300C02Rik A C 1: 37,624,256 S854A probably benign Het
2210016F16Rik T C 13: 58,384,166 D192G probably damaging Het
4921501E09Rik A T 17: 33,066,722 W369R probably damaging Het
A2ml1 T C 6: 128,570,094 probably benign Het
Atp6v1h A T 1: 5,084,454 T2S probably benign Het
Bcl11b G A 12: 107,965,777 P179S probably benign Het
Cacna1a C T 8: 84,580,058 probably benign Het
Ccdc146 C T 5: 21,297,006 probably null Het
Ccdc61 T C 7: 18,892,536 D128G probably damaging Het
Cd55 A G 1: 130,459,576 probably benign Het
Cdk7 C A 13: 100,719,304 E99* probably null Het
Cox8a A T 19: 7,217,509 S2T probably damaging Het
Dennd5a A G 7: 109,899,791 I955T possibly damaging Het
Dopey1 A C 9: 86,512,652 E602A probably benign Het
Ephx4 T C 5: 107,413,078 L32S probably damaging Het
Fbxo21 T A 5: 118,000,490 D493E probably benign Het
Frmd4b A T 6: 97,323,649 probably benign Het
Fzd1 A T 5: 4,756,037 M515K possibly damaging Het
Gli2 A G 1: 118,890,408 probably benign Het
Gm12887 T A 4: 121,616,469 K61N probably damaging Het
Grin2a A T 16: 9,669,807 V409D probably damaging Het
Grin2b T C 6: 135,923,203 I227V probably benign Het
Helz2 T G 2: 181,228,821 D2879A possibly damaging Het
Itpr2 T C 6: 146,323,133 N1453S probably benign Het
Itpr3 C A 17: 27,098,322 S817Y probably damaging Het
Lin7c T A 2: 109,896,453 probably benign Het
Ly75 T C 2: 60,321,918 E1097G probably benign Het
Mcm10 T C 2: 4,991,407 N882D probably damaging Het
Mettl13 A T 1: 162,546,181 L167Q probably damaging Het
Morn2 A T 17: 80,295,513 M1L probably benign Het
Mybph G T 1: 134,193,852 V88L probably damaging Het
Nefm T A 14: 68,121,199 probably benign Het
Nf1 A G 11: 79,471,551 E1497G probably damaging Het
Olfr1281 T A 2: 111,328,525 Y35* probably null Het
Olfr137 T C 17: 38,304,811 S217G possibly damaging Het
Olfr615 A G 7: 103,561,037 K187E probably damaging Het
Olfr670 T A 7: 104,960,496 T79S possibly damaging Het
Plcd3 C G 11: 103,077,585 W382S probably damaging Het
Plxna1 T A 6: 89,329,739 I1370F possibly damaging Het
Rarb G A 14: 16,509,066 R106C probably damaging Het
Rps6ka5 G A 12: 100,678,580 T37I probably damaging Het
Scube1 A G 15: 83,634,736 V301A probably damaging Het
Sema3a A T 5: 13,400,037 N27I possibly damaging Het
Slc15a3 G T 19: 10,843,042 E8* probably null Het
Slc22a5 T C 11: 53,891,206 S112G probably benign Het
Slc25a45 T C 19: 5,880,467 F3L probably damaging Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slfn10-ps A G 11: 83,030,300 noncoding transcript Het
Slit2 C A 5: 48,281,726 C1077* probably null Het
Spn A G 7: 127,136,322 F82L possibly damaging Het
Tbccd1 A G 16: 22,841,905 W54R probably damaging Het
Ucp1 G T 8: 83,290,604 E8* probably null Het
Unc80 A T 1: 66,506,623 probably benign Het
Vsnl1 A T 12: 11,386,986 probably null Het
Zdhhc11 C T 13: 73,982,686 Q295* probably null Het
Zfp457 T A 13: 67,294,034 H63L probably damaging Het
Other mutations in Runx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4382001:Runx1 UTSW 16 92613760 missense probably damaging 0.97
R0315:Runx1 UTSW 16 92605767 missense probably damaging 0.99
R1353:Runx1 UTSW 16 92689051 nonsense probably null
R4059:Runx1 UTSW 16 92644246 missense probably benign 0.09
R4771:Runx1 UTSW 16 92695741 missense possibly damaging 0.70
R4977:Runx1 UTSW 16 92644347 critical splice acceptor site probably null
R5631:Runx1 UTSW 16 92695563 missense possibly damaging 0.94
R6257:Runx1 UTSW 16 92695911 unclassified probably benign
R6435:Runx1 UTSW 16 92644295 missense possibly damaging 0.53
Z1088:Runx1 UTSW 16 92605792 missense probably damaging 1.00
Z1176:Runx1 UTSW 16 92689101 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCAGCAGCCACACTTCTCAGAGTAG -3'
(R):5'- AGGGGCAATGTCCAACAAGCTCAC -3'

Sequencing Primer
(F):5'- GCCACACTTCTCAGAGTAGAGATAC -3'
(R):5'- cctccctctcctcctcctc -3'
Posted On2013-07-11