Mutagenetix > Incidental Mutations

Incidental Mutation 'R0055:Runx1'

58992

Institutional Source

Beutler Lab

Gene Symbol

Runx1

Ensembl Gene

ENSMUSG00000022952

Gene Name

runt related transcription factor 1

Synonyms

AML1, Pebp2a2, Cbfa2, runt domain, alpha subunit 2

MMRRC Submission

038349-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0055 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92601466-92826149 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to T at 92644141 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000131079 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023673] [ENSMUST00000113956] [ENSMUST00000168195]

Predicted Effect

probably benign
Transcript: ENSMUST00000023673

SMART Domains

Protein: ENSMUSP00000023673
Gene: ENSMUSG00000022952

Domain	Start	End	E-Value	Type
low complexity region	42	55	N/A	INTRINSIC
Pfam:Runt	65	194	4.5e-75	PFAM
low complexity region	205	220	N/A	INTRINSIC
PDB:1B8X\|A	333	374	2e-7	PDB
Pfam:RunxI	375	465	1.5e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113956

SMART Domains

Protein: ENSMUSP00000109589
Gene: ENSMUSG00000022952

Domain	Start	End	E-Value	Type
low complexity region	28	41	N/A	INTRINSIC
Pfam:Runt	48	182	3.1e-81	PFAM
low complexity region	270	283	N/A	INTRINSIC
Pfam:RunxI	294	387	4.9e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168195

SMART Domains

Protein: ENSMUSP00000131079
Gene: ENSMUSG00000022952

Domain	Start	End	E-Value	Type
low complexity region	28	41	N/A	INTRINSIC
Pfam:Runt	48	182	4.7e-82	PFAM
low complexity region	191	206	N/A	INTRINSIC
low complexity region	334	347	N/A	INTRINSIC
Pfam:RunxI	358	451	6.4e-43	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Core binding factor (CBF) is a heterodimeric transcription factor that binds to the core element of many enhancers and promoters. The protein encoded by this gene represents the alpha subunit of CBF and is thought to be involved in the development of normal hematopoiesis. Chromosomal translocations involving this gene are well-documented and have been associated with several types of leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations affect hematopoiesis, and in some cases result in defective angiogenesis and intraventricular hemorrhage. Null homozygotes die by embryonic day 12.5; heterozygotes have reduced erythroid and myeloid progenitor numbers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029J07Rik	A	T	8: 45,968,161	S108R	probably damaging	Het
2010300C02Rik	A	C	1: 37,624,256	S854A	probably benign	Het
2210016F16Rik	T	C	13: 58,384,166	D192G	probably damaging	Het
4921501E09Rik	A	T	17: 33,066,722	W369R	probably damaging	Het
A2ml1	T	C	6: 128,570,094		probably benign	Het
Atp6v1h	A	T	1: 5,084,454	T2S	probably benign	Het
Bcl11b	G	A	12: 107,965,777	P179S	probably benign	Het
Cacna1a	C	T	8: 84,580,058		probably benign	Het
Ccdc146	C	T	5: 21,297,006		probably null	Het
Ccdc61	T	C	7: 18,892,536	D128G	probably damaging	Het
Cd55	A	G	1: 130,459,576		probably benign	Het
Cdk7	C	A	13: 100,719,304	E99*	probably null	Het
Cox8a	A	T	19: 7,217,509	S2T	probably damaging	Het
Dennd5a	A	G	7: 109,899,791	I955T	possibly damaging	Het
Dopey1	A	C	9: 86,512,652	E602A	probably benign	Het
Ephx4	T	C	5: 107,413,078	L32S	probably damaging	Het
Fbxo21	T	A	5: 118,000,490	D493E	probably benign	Het
Frmd4b	A	T	6: 97,323,649		probably benign	Het
Fzd1	A	T	5: 4,756,037	M515K	possibly damaging	Het
Gli2	A	G	1: 118,890,408		probably benign	Het
Gm12887	T	A	4: 121,616,469	K61N	probably damaging	Het
Grin2a	A	T	16: 9,669,807	V409D	probably damaging	Het
Grin2b	T	C	6: 135,923,203	I227V	probably benign	Het
Helz2	T	G	2: 181,228,821	D2879A	possibly damaging	Het
Itpr2	T	C	6: 146,323,133	N1453S	probably benign	Het
Itpr3	C	A	17: 27,098,322	S817Y	probably damaging	Het
Lin7c	T	A	2: 109,896,453		probably benign	Het
Ly75	T	C	2: 60,321,918	E1097G	probably benign	Het
Mcm10	T	C	2: 4,991,407	N882D	probably damaging	Het
Mettl13	A	T	1: 162,546,181	L167Q	probably damaging	Het
Morn2	A	T	17: 80,295,513	M1L	probably benign	Het
Mybph	G	T	1: 134,193,852	V88L	probably damaging	Het
Nefm	T	A	14: 68,121,199		probably benign	Het
Nf1	A	G	11: 79,471,551	E1497G	probably damaging	Het
Olfr1281	T	A	2: 111,328,525	Y35*	probably null	Het
Olfr137	T	C	17: 38,304,811	S217G	possibly damaging	Het
Olfr615	A	G	7: 103,561,037	K187E	probably damaging	Het
Olfr670	T	A	7: 104,960,496	T79S	possibly damaging	Het
Plcd3	C	G	11: 103,077,585	W382S	probably damaging	Het
Plxna1	T	A	6: 89,329,739	I1370F	possibly damaging	Het
Rarb	G	A	14: 16,509,066	R106C	probably damaging	Het
Rps6ka5	G	A	12: 100,678,580	T37I	probably damaging	Het
Scube1	A	G	15: 83,634,736	V301A	probably damaging	Het
Sema3a	A	T	5: 13,400,037	N27I	possibly damaging	Het
Slc15a3	G	T	19: 10,843,042	E8*	probably null	Het
Slc22a5	T	C	11: 53,891,206	S112G	probably benign	Het
Slc25a45	T	C	19: 5,880,467	F3L	probably damaging	Het
Slc4a4	A	C	5: 89,156,336	H502P	possibly damaging	Het
Slfn10-ps	A	G	11: 83,030,300		noncoding transcript	Het
Slit2	C	A	5: 48,281,726	C1077*	probably null	Het
Spn	A	G	7: 127,136,322	F82L	possibly damaging	Het
Tbccd1	A	G	16: 22,841,905	W54R	probably damaging	Het
Ucp1	G	T	8: 83,290,604	E8*	probably null	Het
Unc80	A	T	1: 66,506,623		probably benign	Het
Vsnl1	A	T	12: 11,386,986		probably null	Het
Zdhhc11	C	T	13: 73,982,686	Q295*	probably null	Het
Zfp457	T	A	13: 67,294,034	H63L	probably damaging	Het

Other mutations in Runx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
PIT4382001:Runx1	UTSW	16	92613760	missense	probably damaging	0.97
R0315:Runx1	UTSW	16	92605767	missense	probably damaging	0.99
R1353:Runx1	UTSW	16	92689051	nonsense	probably null
R4059:Runx1	UTSW	16	92644246	missense	probably benign	0.09
R4771:Runx1	UTSW	16	92695741	missense	possibly damaging	0.70
R4977:Runx1	UTSW	16	92644347	critical splice acceptor site	probably null
R5631:Runx1	UTSW	16	92695563	missense	possibly damaging	0.94
R6257:Runx1	UTSW	16	92695911	unclassified	probably benign
R6435:Runx1	UTSW	16	92644295	missense	possibly damaging	0.53
Z1088:Runx1	UTSW	16	92605792	missense	probably damaging	1.00
Z1176:Runx1	UTSW	16	92689101	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TCAGCAGCCACACTTCTCAGAGTAG -3'
(R):5'- AGGGGCAATGTCCAACAAGCTCAC -3'

Sequencing Primer
(F):5'- GCCACACTTCTCAGAGTAGAGATAC -3'
(R):5'- cctccctctcctcctcctc -3'

Posted On

2013-07-11