Incidental Mutation 'R7635:Myo5b'
ID589934
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Namemyosin VB
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.688) question?
Stock #R7635 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location74440936-74771493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74580396 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 104 (V104E)
Ref Sequence ENSEMBL: ENSMUSP00000123123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875] [ENSMUST00000125882]
Predicted Effect probably damaging
Transcript: ENSMUST00000074157
AA Change: V106E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: V106E

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120161
Predicted Effect probably damaging
Transcript: ENSMUST00000121875
AA Change: V106E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: V106E

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125882
AA Change: V104E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123123
Gene: ENSMUSG00000025885
AA Change: V104E

DomainStartEndE-ValueType
MYSc 61 183 8.63e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik A C 9: 108,397,406 D236A probably damaging Het
2410089E03Rik A G 15: 8,226,920 I1955V probably benign Het
4833423E24Rik T A 2: 85,500,237 H242L probably benign Het
Adamts7 C T 9: 90,195,245 P1322S probably damaging Het
AI661453 A T 17: 47,467,751 T801S unknown Het
Alpk1 A G 3: 127,695,661 V123A probably benign Het
Ap2b1 T C 11: 83,389,728 V827A probably benign Het
Aqp5 T A 15: 99,594,178 I219N probably benign Het
Astn1 G A 1: 158,667,535 W1051* probably null Het
Atp8b1 T C 18: 64,573,305 D211G possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
Bsn A G 9: 108,110,990 V2521A unknown Het
Car7 T C 8: 104,548,437 V169A probably damaging Het
Catip T A 1: 74,368,962 D484E unknown Het
Ccdc18 T C 5: 108,229,049 probably null Het
Cdyl T C 13: 35,871,651 V518A probably damaging Het
Cep350 A T 1: 155,879,021 C1949* probably null Het
Cinp A G 12: 110,884,013 V18A possibly damaging Het
Clec14a A G 12: 58,268,528 C103R probably damaging Het
Dnah8 G C 17: 30,785,107 E3655Q probably damaging Het
Dnajc11 T C 4: 151,968,611 I164T probably damaging Het
Dnajc13 A T 9: 104,162,367 M2101K probably benign Het
Ephb4 A G 5: 137,372,103 D864G probably damaging Het
Fkbp5 T C 17: 28,428,361 T167A probably benign Het
Foxf2 C A 13: 31,626,104 P9T unknown Het
Frmpd2 C A 14: 33,500,963 H105N possibly damaging Het
Gal3st3 C A 19: 5,307,406 R270S probably damaging Het
Galnt13 A G 2: 54,857,817 I237V probably damaging Het
Gata5 G T 2: 180,333,997 Q125K possibly damaging Het
Gm10036 T A 18: 15,833,289 F166I possibly damaging Het
Gm13084 T C 4: 143,810,417 E448G probably damaging Het
Gon4l A G 3: 88,895,106 N1008S probably benign Het
Got1l1 G A 8: 27,197,934 L356F probably damaging Het
Gse1 A G 8: 120,572,895 E888G unknown Het
Hmx1 C A 5: 35,392,239 P292Q possibly damaging Het
Igkv7-33 A T 6: 70,059,154 S16T probably benign Het
Itga2b C T 11: 102,461,756 G424D probably damaging Het
Itga6 A T 2: 71,843,233 K870N probably benign Het
Lama4 A T 10: 39,092,188 Q1442L probably benign Het
Lamc1 C T 1: 153,249,060 R655H probably damaging Het
Lclat1 C T 17: 73,161,936 S37L probably benign Het
Lrp1b A G 2: 41,123,597 probably null Het
Map3k20 T C 2: 72,402,004 S335P probably benign Het
Micu3 A G 8: 40,366,234 D318G possibly damaging Het
Mmp16 T C 4: 18,054,382 I296T probably benign Het
Mmp20 A T 9: 7,639,334 I168L probably benign Het
Mpp3 T C 11: 102,025,383 K48E probably damaging Het
Muc5ac A T 7: 141,805,676 D1291V probably damaging Het
Muc5ac A T 7: 141,805,753 T1317S possibly damaging Het
Myl10 A T 5: 136,700,864 M119L probably benign Het
Nek10 G A 14: 14,850,932 V326M probably benign Het
Olfr1348 G A 7: 6,501,582 L221F probably benign Het
Olfr323 T A 11: 58,625,164 E107D unknown Het
Olfr791 A T 10: 129,526,682 M152L probably benign Het
Pcnx A G 12: 81,919,125 T161A Het
Peg10 T C 6: 4,754,938 S240P probably damaging Het
Pex6 G A 17: 46,724,017 V822M probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Pld5 A T 1: 175,993,850 probably null Het
Plxna4 A G 6: 32,496,741 V447A probably damaging Het
Pou2af1 T C 9: 51,232,983 S66P probably benign Het
Prl2c2 T C 13: 12,997,343 D147G probably damaging Het
Prune1 A G 3: 95,255,285 L359P probably damaging Het
Rab4b A T 7: 27,176,217 V13E probably damaging Het
Rbbp6 T G 7: 122,976,008 V80G possibly damaging Het
Reep5 C T 18: 34,349,800 G119S possibly damaging Het
Rem1 G C 2: 152,634,665 R281P probably damaging Het
Rnf215 C T 11: 4,139,989 R309C probably damaging Het
Scn4a C A 11: 106,324,632 V1173F probably damaging Het
Serpine3 A T 14: 62,673,015 I186F possibly damaging Het
Slc7a1 A G 5: 148,352,236 V67A probably damaging Het
Smco2 A T 6: 146,860,009 E142V possibly damaging Het
Spata25 G A 2: 164,827,969 P41S probably benign Het
Specc1l A G 10: 75,276,804 D955G probably damaging Het
Spns3 C T 11: 72,539,034 probably null Het
Sptbn2 C T 19: 4,744,207 R1480C probably damaging Het
Taf1a T C 1: 183,408,434 probably null Het
Tas2r107 G T 6: 131,659,600 T162K possibly damaging Het
Tcea1 T C 1: 4,889,551 S139P probably benign Het
Tecta C T 9: 42,330,987 V2102I probably benign Het
Tmem131 A T 1: 36,872,548 I106K probably damaging Het
Tpbpb A G 13: 60,902,111 V68A probably benign Het
Ttc27 A T 17: 74,718,715 N61I probably benign Het
Ttn T C 2: 76,749,677 N23624S probably damaging Het
Usp2 T C 9: 44,067,222 probably null Het
Vmn1r10 A G 6: 57,114,041 H206R probably benign Het
Vmn1r234 T C 17: 21,229,217 I131T probably damaging Het
Vwf G T 6: 125,682,734 R2632L Het
Wdr36 T C 18: 32,850,525 L443P probably benign Het
Zcchc6 T C 13: 59,800,090 K806E probably benign Het
Zfp143 T C 7: 110,088,818 V489A probably benign Het
Zfp383 G A 7: 29,915,271 R317Q probably damaging Het
Zswim8 A G 14: 20,716,300 T839A probably damaging Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74654076 splice site probably benign
IGL01083:Myo5b APN 18 74733903 splice site probably benign
IGL01448:Myo5b APN 18 74644090 missense probably damaging 0.97
IGL01516:Myo5b APN 18 74627195 missense probably damaging 0.99
IGL01525:Myo5b APN 18 74740549 missense probably damaging 1.00
IGL01873:Myo5b APN 18 74580396 missense probably damaging 1.00
IGL01887:Myo5b APN 18 74714936 missense probably benign 0.41
IGL01953:Myo5b APN 18 74569767 missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74698277 missense probably damaging 1.00
IGL02017:Myo5b APN 18 74716999 missense probably damaging 1.00
IGL02331:Myo5b APN 18 74638040 critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74714939 missense probably damaging 0.98
IGL02707:Myo5b APN 18 74695367 splice site probably benign
IGL02806:Myo5b APN 18 74617080 critical splice donor site probably null
IGL03009:Myo5b APN 18 74760968 missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74634559 missense probably benign 0.02
IGL03061:Myo5b APN 18 74580544 splice site probably benign
unrat UTSW 18 74653361 missense possibly damaging 0.93
R0085:Myo5b UTSW 18 74701680 missense probably benign 0.21
R0114:Myo5b UTSW 18 74742171 missense probably benign 0.03
R0226:Myo5b UTSW 18 74742180 missense probably benign
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74728954 splice site probably benign
R0494:Myo5b UTSW 18 74653967 missense probably damaging 1.00
R0920:Myo5b UTSW 18 74625641 missense probably benign 0.09
R1144:Myo5b UTSW 18 74625587 missense probably damaging 1.00
R1177:Myo5b UTSW 18 74644072 missense probably damaging 1.00
R1387:Myo5b UTSW 18 74644201 splice site probably benign
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1555:Myo5b UTSW 18 74569782 missense probably damaging 1.00
R1587:Myo5b UTSW 18 74733990 missense probably benign
R1600:Myo5b UTSW 18 74713540 unclassified probably benign
R1639:Myo5b UTSW 18 74707916 missense probably benign 0.19
R1779:Myo5b UTSW 18 74742147 missense probably benign 0.06
R1806:Myo5b UTSW 18 74577609 missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2046:Myo5b UTSW 18 74577455 missense probably benign 0.28
R2093:Myo5b UTSW 18 74759192 missense probably damaging 0.98
R2270:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2272:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2298:Myo5b UTSW 18 74625605 missense probably damaging 1.00
R2433:Myo5b UTSW 18 74759087 missense probably damaging 1.00
R2888:Myo5b UTSW 18 74762618 missense probably damaging 1.00
R3824:Myo5b UTSW 18 74661655 missense probably benign 0.41
R3937:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3938:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3947:Myo5b UTSW 18 74695403 missense probably damaging 1.00
R3971:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3972:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3974:Myo5b UTSW 18 74634481 missense probably damaging 1.00
R4027:Myo5b UTSW 18 74759240 missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74740488 missense probably benign
R4285:Myo5b UTSW 18 74714849 missense probably benign
R4308:Myo5b UTSW 18 74731740 missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74698274 missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74580408 missense probably damaging 1.00
R4516:Myo5b UTSW 18 74625674 missense probably damaging 1.00
R4690:Myo5b UTSW 18 74722462 missense probably damaging 0.97
R4781:Myo5b UTSW 18 74744681 missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74695380 missense probably benign 0.01
R4796:Myo5b UTSW 18 74744630 missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74695384 missense probably benign 0.19
R4972:Myo5b UTSW 18 74627193 missense probably damaging 0.98
R5004:Myo5b UTSW 18 74744773 critical splice donor site probably null
R5024:Myo5b UTSW 18 74716034 missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74638153 critical splice donor site probably null
R5187:Myo5b UTSW 18 74701674 missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74714932 missense probably damaging 0.99
R5254:Myo5b UTSW 18 74700606 missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74662670 missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74742175 missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74654057 missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74701521 missense probably benign
R5875:Myo5b UTSW 18 74707902 synonymous probably null
R6088:Myo5b UTSW 18 74720898 missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74700679 missense probably benign 0.19
R6237:Myo5b UTSW 18 74742178 missense probably damaging 1.00
R6265:Myo5b UTSW 18 74577440 splice site probably null
R6267:Myo5b UTSW 18 74616991 missense probably damaging 1.00
R6328:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6330:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6331:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6347:Myo5b UTSW 18 74770385 missense probably benign 0.11
R6479:Myo5b UTSW 18 74617015 missense probably damaging 1.00
R6748:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74617035 missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74770325 missense probably benign
R6876:Myo5b UTSW 18 74707955 missense probably benign
R6880:Myo5b UTSW 18 74722430 missense probably benign 0.02
R6902:Myo5b UTSW 18 74676685 missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74653361 missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74701528 missense probably benign 0.01
R7162:Myo5b UTSW 18 74695427 missense probably benign 0.02
R7345:Myo5b UTSW 18 74708024 missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74731731 missense probably benign 0.00
R7564:Myo5b UTSW 18 74634511 missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74627254 critical splice donor site probably null
R7670:Myo5b UTSW 18 74701446 missense probably benign 0.05
R7754:Myo5b UTSW 18 74634559 missense probably benign 0.02
RF009:Myo5b UTSW 18 74643999 missense probably damaging 1.00
Z1088:Myo5b UTSW 18 74744749 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AGTGTGGCTGTGCTATTCCC -3'
(R):5'- CATCCTGTAAGGTAGACAACTCC -3'

Sequencing Primer
(F):5'- TGTGCTATTCCCACGGGACAAC -3'
(R):5'- GTAAGGTAGACAACTCCCCTTCGTG -3'
Posted On2019-10-24