Incidental Mutation 'R7636:Gbgt1'
ID589940
Institutional Source Beutler Lab
Gene Symbol Gbgt1
Ensembl Gene ENSMUSG00000026829
Gene Namegloboside alpha-1,3-N-acetylgalactosaminyltransferase 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7636 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location28496891-28505415 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28505314 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 321 (D321E)
Ref Sequence ENSEMBL: ENSMUSP00000028172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028172] [ENSMUST00000074761] [ENSMUST00000163121]
Predicted Effect probably damaging
Transcript: ENSMUST00000028172
AA Change: D321E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028172
Gene: ENSMUSG00000026829
AA Change: D321E

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Glyco_transf_6 33 347 1.6e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074761
SMART Domains Protein: ENSMUSP00000082978
Gene: ENSMUSG00000063611

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163121
AA Change: D321E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127071
Gene: ENSMUSG00000026829
AA Change: D321E

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 11 347 1.9e-152 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyltransferase that plays a role in the synthesis of Forssman glycolipid (FG), a member of the globoseries glycolipid family. Glycolipids such as FG form attachment sites for the binding of pathogens to cells; expression of this protein may determine host tropism to microorganisms. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik C T 16: 17,117,837 E199K possibly damaging Het
4932415D10Rik T A 10: 82,295,139 D679V probably benign Het
Akap13 C A 7: 75,609,873 N748K probably benign Het
Aldh16a1 G T 7: 45,147,531 P58T unknown Het
Amhr2 T A 15: 102,452,458 C343S probably damaging Het
Ankrd17 A T 5: 90,232,380 M2483K possibly damaging Het
Ano3 A T 2: 110,682,703 L649* probably null Het
Apob T C 12: 8,009,516 I2666T possibly damaging Het
C1ql3 A T 2: 13,010,810 V13E probably benign Het
Casp12 A G 9: 5,358,344 I384V probably benign Het
Clcn1 A T 6: 42,291,334 K147* probably null Het
Ctnna1 T A 18: 35,223,473 N398K possibly damaging Het
Dcdc2a A T 13: 25,102,622 K176M probably damaging Het
Depdc5 T A 5: 32,917,983 S502T probably benign Het
Fam166a A T 2: 25,218,820 H7L probably damaging Het
Fam83e G A 7: 45,727,026 D388N probably damaging Het
Fbxl15 G A 19: 46,329,175 E99K probably benign Het
Fbxw2 T C 2: 34,812,944 T186A probably benign Het
Frem2 T A 3: 53,653,247 M1280L probably benign Het
Gm4788 A G 1: 139,739,322 V405A probably benign Het
Gsdmc2 T A 15: 63,828,192 T244S probably benign Het
Heatr5a C A 12: 51,888,196 G1675W probably damaging Het
Heatr5a G A 12: 51,952,558 L287F probably damaging Het
Hfm1 C A 5: 106,917,466 A116S probably benign Het
Insr A G 8: 3,258,709 I109T probably damaging Het
Itga4 A G 2: 79,313,832 I688V probably benign Het
Lipe A G 7: 25,388,617 M49T probably benign Het
Lrriq3 A G 3: 155,188,150 Y496C probably damaging Het
Lyst T C 13: 13,616,747 probably null Het
Megf10 T A 18: 57,276,989 I614N possibly damaging Het
Mkx A G 18: 7,000,630 I104T possibly damaging Het
Mrgpra4 C A 7: 47,980,973 L293F possibly damaging Het
Olfm2 A G 9: 20,668,297 V386A possibly damaging Het
Olfr1234 A T 2: 89,363,239 Y63* probably null Het
Olfr317 A T 11: 58,732,447 N239K possibly damaging Het
Olfr605 C A 7: 103,442,833 D97Y probably damaging Het
Pkd2l1 G T 19: 44,191,431 D113E possibly damaging Het
Rab11fip2 A T 19: 59,942,885 I39K possibly damaging Het
Rab1b A T 19: 5,100,782 V99E probably damaging Het
Rad54l2 A T 9: 106,720,387 L140Q probably damaging Het
Repin1 T C 6: 48,596,365 F76S probably benign Het
Robo1 A G 16: 72,563,727 D9G Het
Scn3a A G 2: 65,497,689 L819P probably damaging Het
Scn7a A T 2: 66,743,828 N150K possibly damaging Het
Sh2d3c T C 2: 32,725,011 S38P probably benign Het
Sin3b A T 8: 72,747,734 K549* probably null Het
Sorl1 A G 9: 42,092,334 F222S possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem179 C T 12: 112,510,743 probably null Het
Tubg2 A T 11: 101,160,087 I213F probably damaging Het
Zfhx3 T C 8: 108,946,809 I1497T probably benign Het
Zfp128 A T 7: 12,890,112 M136L probably benign Het
Zzz3 G A 3: 152,427,652 A116T probably benign Het
Other mutations in Gbgt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Gbgt1 APN 2 28502195 critical splice acceptor site probably null
IGL01586:Gbgt1 APN 2 28497830 missense probably benign 0.00
R0031:Gbgt1 UTSW 2 28498450 splice site probably benign
R0693:Gbgt1 UTSW 2 28504830 missense probably damaging 0.99
R1623:Gbgt1 UTSW 2 28504976 missense probably benign 0.38
R1739:Gbgt1 UTSW 2 28505052 missense possibly damaging 0.55
R2221:Gbgt1 UTSW 2 28498423 missense probably damaging 1.00
R4418:Gbgt1 UTSW 2 28498408 missense probably damaging 1.00
R4674:Gbgt1 UTSW 2 28498441 missense possibly damaging 0.87
R4675:Gbgt1 UTSW 2 28498441 missense possibly damaging 0.87
R4926:Gbgt1 UTSW 2 28503170 missense probably damaging 0.99
R5254:Gbgt1 UTSW 2 28505208 missense probably damaging 1.00
R5341:Gbgt1 UTSW 2 28505007 missense probably damaging 1.00
R5399:Gbgt1 UTSW 2 28503218 missense probably damaging 1.00
R6562:Gbgt1 UTSW 2 28504886 missense probably damaging 0.99
R6658:Gbgt1 UTSW 2 28504986 missense probably benign 0.00
R6830:Gbgt1 UTSW 2 28505208 missense probably damaging 1.00
R7466:Gbgt1 UTSW 2 28502207 missense probably damaging 0.96
R7839:Gbgt1 UTSW 2 28503170 missense probably damaging 0.99
R7922:Gbgt1 UTSW 2 28503170 missense probably damaging 0.99
Z1177:Gbgt1 UTSW 2 28505188 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTCTATTATGGTGGGGCAC -3'
(R):5'- TCCAACCAATCATGTGCTGG -3'

Sequencing Primer
(F):5'- GCACTCTTTGGGGGACGAG -3'
(R):5'- CAACCAATCATGTGCTGGATTGC -3'
Posted On2019-10-24