Incidental Mutation 'R7636:Hfm1'
ID 589953
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene Name HFM1, ATP-dependent DNA helicase homolog
Synonyms LOC381663, A330009G12Rik, Mer3, Sec63d1
MMRRC Submission 045722-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R7636 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 106988058-107074187 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 107065332 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 116 (A116S)
Ref Sequence ENSEMBL: ENSMUSP00000142727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148686] [ENSMUST00000200249]
AlphaFold D3Z4R1
Predicted Effect probably benign
Transcript: ENSMUST00000112690
AA Change: A116S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: A116S

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117588
AA Change: A116S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: A116S

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148686
Predicted Effect probably benign
Transcript: ENSMUST00000200249
AA Change: A116S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000142727
Gene: ENSMUSG00000043410
AA Change: A116S

DomainStartEndE-ValueType
Pfam:ResIII 260 410 9.9e-7 PFAM
Pfam:DEAD 281 410 1.5e-19 PFAM
Meta Mutation Damage Score 0.1116 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik C T 16: 16,935,701 (GRCm39) E199K possibly damaging Het
Akap13 C A 7: 75,259,621 (GRCm39) N748K probably benign Het
Aldh16a1 G T 7: 44,796,955 (GRCm39) P58T unknown Het
Amhr2 T A 15: 102,360,893 (GRCm39) C343S probably damaging Het
Ankrd17 A T 5: 90,380,239 (GRCm39) M2483K possibly damaging Het
Ano3 A T 2: 110,513,048 (GRCm39) L649* probably null Het
Apob T C 12: 8,059,516 (GRCm39) I2666T possibly damaging Het
C1ql3 A T 2: 13,015,621 (GRCm39) V13E probably benign Het
Casp12 A G 9: 5,358,344 (GRCm39) I384V probably benign Het
Cimip2a A T 2: 25,108,832 (GRCm39) H7L probably damaging Het
Clcn1 A T 6: 42,268,268 (GRCm39) K147* probably null Het
Ctnna1 T A 18: 35,356,526 (GRCm39) N398K possibly damaging Het
Dcdc2a A T 13: 25,286,605 (GRCm39) K176M probably damaging Het
Depdc5 T A 5: 33,075,327 (GRCm39) S502T probably benign Het
Fam83e G A 7: 45,376,450 (GRCm39) D388N probably damaging Het
Fbxl15 G A 19: 46,317,614 (GRCm39) E99K probably benign Het
Fbxw2 T C 2: 34,702,956 (GRCm39) T186A probably benign Het
Frem2 T A 3: 53,560,668 (GRCm39) M1280L probably benign Het
Gbgt1 T A 2: 28,395,326 (GRCm39) D321E probably damaging Het
Gsdmc2 T A 15: 63,700,041 (GRCm39) T244S probably benign Het
Heatr5a C A 12: 51,934,979 (GRCm39) G1675W probably damaging Het
Heatr5a G A 12: 51,999,341 (GRCm39) L287F probably damaging Het
Insr A G 8: 3,308,709 (GRCm39) I109T probably damaging Het
Itga4 A G 2: 79,144,176 (GRCm39) I688V probably benign Het
Lipe A G 7: 25,088,042 (GRCm39) M49T probably benign Het
Lrriq3 A G 3: 154,893,787 (GRCm39) Y496C probably damaging Het
Lyst T C 13: 13,791,332 (GRCm39) probably null Het
Megf10 T A 18: 57,410,061 (GRCm39) I614N possibly damaging Het
Mkx A G 18: 7,000,630 (GRCm39) I104T possibly damaging Het
Mrgpra4 C A 7: 47,630,721 (GRCm39) L293F possibly damaging Het
Olfm2 A G 9: 20,579,593 (GRCm39) V386A possibly damaging Het
Or2w3b A T 11: 58,623,273 (GRCm39) N239K possibly damaging Het
Or4a15 A T 2: 89,193,583 (GRCm39) Y63* probably null Het
Or52s6 C A 7: 103,092,040 (GRCm39) D97Y probably damaging Het
Pkd2l1 G T 19: 44,179,870 (GRCm39) D113E possibly damaging Het
Rab11fip2 A T 19: 59,931,317 (GRCm39) I39K possibly damaging Het
Rab1b A T 19: 5,150,810 (GRCm39) V99E probably damaging Het
Rad54l2 A T 9: 106,597,586 (GRCm39) L140Q probably damaging Het
Repin1 T C 6: 48,573,299 (GRCm39) F76S probably benign Het
Robo1 A G 16: 72,360,615 (GRCm39) D9G Het
Scn3a A G 2: 65,328,033 (GRCm39) L819P probably damaging Het
Scn7a A T 2: 66,574,172 (GRCm39) N150K possibly damaging Het
Sh2d3c T C 2: 32,615,023 (GRCm39) S38P probably benign Het
Sin3b A T 8: 73,474,362 (GRCm39) K549* probably null Het
Sorl1 A G 9: 42,003,630 (GRCm39) F222S possibly damaging Het
Spata31h1 T A 10: 82,130,973 (GRCm39) D679V probably benign Het
Tmem147 A T 7: 30,427,726 (GRCm39) probably null Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Tmem179 C T 12: 112,477,177 (GRCm39) probably null Het
Tubg2 A T 11: 101,050,913 (GRCm39) I213F probably damaging Het
Zfhx3 T C 8: 109,673,441 (GRCm39) I1497T probably benign Het
Zfp128 A T 7: 12,624,039 (GRCm39) M136L probably benign Het
Zzz3 G A 3: 152,133,289 (GRCm39) A116T probably benign Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 107,049,996 (GRCm39) missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 107,065,472 (GRCm39) missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 107,065,245 (GRCm39) missense probably benign 0.00
IGL01758:Hfm1 APN 5 107,052,659 (GRCm39) missense probably damaging 0.99
IGL01911:Hfm1 APN 5 107,059,410 (GRCm39) missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 107,052,133 (GRCm39) missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 107,021,794 (GRCm39) splice site probably benign
IGL02496:Hfm1 APN 5 107,049,627 (GRCm39) missense probably benign 0.00
IGL02545:Hfm1 APN 5 107,043,153 (GRCm39) missense probably damaging 1.00
IGL02584:Hfm1 APN 5 107,026,528 (GRCm39) splice site probably null
IGL02728:Hfm1 APN 5 107,026,689 (GRCm39) missense probably benign 0.13
IGL02881:Hfm1 APN 5 107,022,118 (GRCm39) missense probably damaging 1.00
IGL03108:Hfm1 APN 5 107,043,800 (GRCm39) unclassified probably benign
IGL03351:Hfm1 APN 5 107,059,441 (GRCm39) nonsense probably null
IGL03353:Hfm1 APN 5 107,004,795 (GRCm39) missense probably damaging 0.99
R0024:Hfm1 UTSW 5 107,004,790 (GRCm39) missense probably benign 0.41
R0024:Hfm1 UTSW 5 107,004,790 (GRCm39) missense probably benign 0.41
R0094:Hfm1 UTSW 5 107,065,344 (GRCm39) missense probably benign
R0633:Hfm1 UTSW 5 107,065,467 (GRCm39) missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 107,046,122 (GRCm39) critical splice donor site probably null
R1078:Hfm1 UTSW 5 107,026,696 (GRCm39) missense probably damaging 1.00
R1120:Hfm1 UTSW 5 107,052,084 (GRCm39) splice site probably benign
R1166:Hfm1 UTSW 5 107,059,277 (GRCm39) missense probably benign 0.00
R1242:Hfm1 UTSW 5 107,022,767 (GRCm39) missense probably damaging 0.99
R1414:Hfm1 UTSW 5 107,020,219 (GRCm39) missense probably benign 0.01
R1450:Hfm1 UTSW 5 107,066,324 (GRCm39) missense probably damaging 0.99
R1529:Hfm1 UTSW 5 107,000,989 (GRCm39) missense probably benign 0.00
R1622:Hfm1 UTSW 5 107,041,389 (GRCm39) missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 107,043,869 (GRCm39) missense probably damaging 0.96
R1710:Hfm1 UTSW 5 107,028,380 (GRCm39) missense probably damaging 1.00
R1757:Hfm1 UTSW 5 107,028,226 (GRCm39) splice site probably null
R1856:Hfm1 UTSW 5 106,995,542 (GRCm39) missense probably benign 0.00
R1984:Hfm1 UTSW 5 107,046,442 (GRCm39) missense probably damaging 0.98
R1985:Hfm1 UTSW 5 107,046,442 (GRCm39) missense probably damaging 0.98
R2040:Hfm1 UTSW 5 107,049,684 (GRCm39) missense probably damaging 1.00
R2122:Hfm1 UTSW 5 107,044,121 (GRCm39) missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106,995,519 (GRCm39) splice site probably null
R2474:Hfm1 UTSW 5 107,020,282 (GRCm39) missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 107,022,148 (GRCm39) nonsense probably null
R2944:Hfm1 UTSW 5 107,020,196 (GRCm39) missense probably damaging 1.00
R3705:Hfm1 UTSW 5 107,040,705 (GRCm39) unclassified probably benign
R4256:Hfm1 UTSW 5 107,052,663 (GRCm39) missense possibly damaging 0.83
R4455:Hfm1 UTSW 5 107,034,374 (GRCm39) splice site probably null
R4538:Hfm1 UTSW 5 107,022,756 (GRCm39) missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 107,022,087 (GRCm39) nonsense probably null
R4591:Hfm1 UTSW 5 106,995,533 (GRCm39) missense probably benign 0.08
R4745:Hfm1 UTSW 5 107,049,709 (GRCm39) missense possibly damaging 0.87
R4747:Hfm1 UTSW 5 107,065,389 (GRCm39) missense probably benign
R4765:Hfm1 UTSW 5 106,990,405 (GRCm39) missense probably benign 0.21
R4821:Hfm1 UTSW 5 107,002,606 (GRCm39) critical splice donor site probably null
R4842:Hfm1 UTSW 5 107,040,617 (GRCm39) missense probably damaging 1.00
R4944:Hfm1 UTSW 5 107,022,079 (GRCm39) missense possibly damaging 0.46
R5093:Hfm1 UTSW 5 107,049,597 (GRCm39) missense probably damaging 1.00
R5399:Hfm1 UTSW 5 107,065,428 (GRCm39) missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 107,049,942 (GRCm39) missense probably damaging 1.00
R5436:Hfm1 UTSW 5 107,040,638 (GRCm39) missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 107,052,629 (GRCm39) missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106,995,528 (GRCm39) critical splice donor site probably null
R5585:Hfm1 UTSW 5 107,059,305 (GRCm39) missense probably benign 0.05
R5631:Hfm1 UTSW 5 107,052,629 (GRCm39) missense probably damaging 1.00
R5705:Hfm1 UTSW 5 107,059,319 (GRCm39) missense probably benign 0.21
R5804:Hfm1 UTSW 5 107,026,455 (GRCm39) splice site probably null
R5959:Hfm1 UTSW 5 107,022,783 (GRCm39) missense probably damaging 1.00
R6046:Hfm1 UTSW 5 107,046,509 (GRCm39) splice site probably null
R6191:Hfm1 UTSW 5 107,034,419 (GRCm39) missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106,989,504 (GRCm39) missense probably benign
R6580:Hfm1 UTSW 5 106,995,575 (GRCm39) missense probably benign 0.00
R6651:Hfm1 UTSW 5 106,995,553 (GRCm39) missense probably benign 0.00
R6761:Hfm1 UTSW 5 107,043,145 (GRCm39) missense probably damaging 1.00
R6835:Hfm1 UTSW 5 107,026,681 (GRCm39) nonsense probably null
R6891:Hfm1 UTSW 5 107,065,240 (GRCm39) missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106,998,276 (GRCm39) splice site probably null
R6980:Hfm1 UTSW 5 107,028,343 (GRCm39) missense probably benign 0.31
R7054:Hfm1 UTSW 5 107,043,909 (GRCm39) missense probably benign 0.01
R7058:Hfm1 UTSW 5 107,059,306 (GRCm39) missense probably benign 0.04
R7189:Hfm1 UTSW 5 107,049,569 (GRCm39) critical splice donor site probably null
R7250:Hfm1 UTSW 5 107,052,197 (GRCm39) missense probably benign 0.00
R7376:Hfm1 UTSW 5 107,043,084 (GRCm39) missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 107,043,909 (GRCm39) missense probably benign 0.01
R7639:Hfm1 UTSW 5 107,046,341 (GRCm39) missense possibly damaging 0.46
R7639:Hfm1 UTSW 5 107,037,791 (GRCm39) missense probably benign 0.03
R7763:Hfm1 UTSW 5 107,029,727 (GRCm39) missense probably damaging 1.00
R7828:Hfm1 UTSW 5 107,029,657 (GRCm39) critical splice donor site probably null
R7905:Hfm1 UTSW 5 107,046,419 (GRCm39) missense probably damaging 1.00
R8160:Hfm1 UTSW 5 107,043,899 (GRCm39) missense probably null 0.00
R8477:Hfm1 UTSW 5 107,029,684 (GRCm39) missense probably benign 0.01
R8739:Hfm1 UTSW 5 107,046,371 (GRCm39) missense probably damaging 0.96
R8968:Hfm1 UTSW 5 107,065,439 (GRCm39) missense probably benign 0.00
R9072:Hfm1 UTSW 5 107,046,146 (GRCm39) missense probably benign 0.04
R9073:Hfm1 UTSW 5 107,046,146 (GRCm39) missense probably benign 0.04
R9152:Hfm1 UTSW 5 106,989,611 (GRCm39) missense probably benign 0.01
R9234:Hfm1 UTSW 5 107,041,334 (GRCm39) missense probably benign
R9244:Hfm1 UTSW 5 107,022,766 (GRCm39) missense probably damaging 0.96
R9576:Hfm1 UTSW 5 107,021,938 (GRCm39) missense probably benign 0.00
R9649:Hfm1 UTSW 5 107,066,329 (GRCm39) missense possibly damaging 0.82
R9743:Hfm1 UTSW 5 107,022,125 (GRCm39) missense possibly damaging 0.55
R9782:Hfm1 UTSW 5 107,021,896 (GRCm39) missense probably benign 0.38
R9789:Hfm1 UTSW 5 107,065,346 (GRCm39) missense probably benign 0.00
Z1177:Hfm1 UTSW 5 107,019,686 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTATCCCAGGCCTGATAC -3'
(R):5'- CTCAGTGCATGGTTCTTGTAATATTCG -3'

Sequencing Primer
(F):5'- TCCCAGGCCTGATACTCATATAAAC -3'
(R):5'- CACTGTCTGTGTAGTCAGAGAAC -3'
Posted On 2019-10-24