Incidental Mutation 'R7636:Aldh16a1'
ID 589958
Institutional Source Beutler Lab
Gene Symbol Aldh16a1
Ensembl Gene ENSMUSG00000007833
Gene Name aldehyde dehydrogenase 16 family, member A1
Synonyms 2410004H02Rik
MMRRC Submission 045722-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7636 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 44791257-44804008 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 44796955 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 58 (P58T)
Ref Sequence ENSEMBL: ENSMUSP00000147622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107815] [ENSMUST00000209957] [ENSMUST00000209963] [ENSMUST00000210125] [ENSMUST00000211169] [ENSMUST00000211362]
AlphaFold no structure available at present
Predicted Effect silent
Transcript: ENSMUST00000107815
SMART Domains Protein: ENSMUSP00000103445
Gene: ENSMUSG00000007833

DomainStartEndE-ValueType
Pfam:Aldedh 48 488 3.8e-87 PFAM
Pfam:Aldedh 536 753 2.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209957
Predicted Effect silent
Transcript: ENSMUST00000209963
Predicted Effect unknown
Transcript: ENSMUST00000210125
AA Change: P58T
Predicted Effect probably benign
Transcript: ENSMUST00000211169
Predicted Effect probably benign
Transcript: ENSMUST00000211362
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldehyde dehydrogenase superfamily. The family members act on aldehyde substrates and use nicotinamide adenine dinucleotide phosphate (NADP) as a cofactor. This gene is conserved in chimpanzee, dog, cow, mouse, rat, and zebrafish. The protein encoded by this gene interacts with maspardin, a protein that when truncated is responsible for Mast syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik C T 16: 16,935,701 (GRCm39) E199K possibly damaging Het
Akap13 C A 7: 75,259,621 (GRCm39) N748K probably benign Het
Amhr2 T A 15: 102,360,893 (GRCm39) C343S probably damaging Het
Ankrd17 A T 5: 90,380,239 (GRCm39) M2483K possibly damaging Het
Ano3 A T 2: 110,513,048 (GRCm39) L649* probably null Het
Apob T C 12: 8,059,516 (GRCm39) I2666T possibly damaging Het
C1ql3 A T 2: 13,015,621 (GRCm39) V13E probably benign Het
Casp12 A G 9: 5,358,344 (GRCm39) I384V probably benign Het
Cimip2a A T 2: 25,108,832 (GRCm39) H7L probably damaging Het
Clcn1 A T 6: 42,268,268 (GRCm39) K147* probably null Het
Ctnna1 T A 18: 35,356,526 (GRCm39) N398K possibly damaging Het
Dcdc2a A T 13: 25,286,605 (GRCm39) K176M probably damaging Het
Depdc5 T A 5: 33,075,327 (GRCm39) S502T probably benign Het
Fam83e G A 7: 45,376,450 (GRCm39) D388N probably damaging Het
Fbxl15 G A 19: 46,317,614 (GRCm39) E99K probably benign Het
Fbxw2 T C 2: 34,702,956 (GRCm39) T186A probably benign Het
Frem2 T A 3: 53,560,668 (GRCm39) M1280L probably benign Het
Gbgt1 T A 2: 28,395,326 (GRCm39) D321E probably damaging Het
Gsdmc2 T A 15: 63,700,041 (GRCm39) T244S probably benign Het
Heatr5a C A 12: 51,934,979 (GRCm39) G1675W probably damaging Het
Heatr5a G A 12: 51,999,341 (GRCm39) L287F probably damaging Het
Hfm1 C A 5: 107,065,332 (GRCm39) A116S probably benign Het
Insr A G 8: 3,308,709 (GRCm39) I109T probably damaging Het
Itga4 A G 2: 79,144,176 (GRCm39) I688V probably benign Het
Lipe A G 7: 25,088,042 (GRCm39) M49T probably benign Het
Lrriq3 A G 3: 154,893,787 (GRCm39) Y496C probably damaging Het
Lyst T C 13: 13,791,332 (GRCm39) probably null Het
Megf10 T A 18: 57,410,061 (GRCm39) I614N possibly damaging Het
Mkx A G 18: 7,000,630 (GRCm39) I104T possibly damaging Het
Mrgpra4 C A 7: 47,630,721 (GRCm39) L293F possibly damaging Het
Olfm2 A G 9: 20,579,593 (GRCm39) V386A possibly damaging Het
Or2w3b A T 11: 58,623,273 (GRCm39) N239K possibly damaging Het
Or4a15 A T 2: 89,193,583 (GRCm39) Y63* probably null Het
Or52s6 C A 7: 103,092,040 (GRCm39) D97Y probably damaging Het
Pkd2l1 G T 19: 44,179,870 (GRCm39) D113E possibly damaging Het
Rab11fip2 A T 19: 59,931,317 (GRCm39) I39K possibly damaging Het
Rab1b A T 19: 5,150,810 (GRCm39) V99E probably damaging Het
Rad54l2 A T 9: 106,597,586 (GRCm39) L140Q probably damaging Het
Repin1 T C 6: 48,573,299 (GRCm39) F76S probably benign Het
Robo1 A G 16: 72,360,615 (GRCm39) D9G Het
Scn3a A G 2: 65,328,033 (GRCm39) L819P probably damaging Het
Scn7a A T 2: 66,574,172 (GRCm39) N150K possibly damaging Het
Sh2d3c T C 2: 32,615,023 (GRCm39) S38P probably benign Het
Sin3b A T 8: 73,474,362 (GRCm39) K549* probably null Het
Sorl1 A G 9: 42,003,630 (GRCm39) F222S possibly damaging Het
Spata31h1 T A 10: 82,130,973 (GRCm39) D679V probably benign Het
Tmem147 A T 7: 30,427,726 (GRCm39) probably null Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Tmem179 C T 12: 112,477,177 (GRCm39) probably null Het
Tubg2 A T 11: 101,050,913 (GRCm39) I213F probably damaging Het
Zfhx3 T C 8: 109,673,441 (GRCm39) I1497T probably benign Het
Zfp128 A T 7: 12,624,039 (GRCm39) M136L probably benign Het
Zzz3 G A 3: 152,133,289 (GRCm39) A116T probably benign Het
Other mutations in Aldh16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Aldh16a1 APN 7 44,794,937 (GRCm39) missense probably benign 0.00
IGL01449:Aldh16a1 APN 7 44,791,391 (GRCm39) missense probably damaging 0.99
IGL01599:Aldh16a1 APN 7 44,791,517 (GRCm39) missense probably damaging 0.99
IGL02118:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02120:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02123:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02125:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02126:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02794:Aldh16a1 APN 7 44,795,018 (GRCm39) missense probably damaging 0.98
IGL03348:Aldh16a1 APN 7 44,791,399 (GRCm39) missense possibly damaging 0.85
G1Funyon:Aldh16a1 UTSW 7 44,791,406 (GRCm39) missense possibly damaging 0.80
R0242:Aldh16a1 UTSW 7 44,794,088 (GRCm39) missense probably damaging 1.00
R0242:Aldh16a1 UTSW 7 44,794,088 (GRCm39) missense probably damaging 1.00
R0305:Aldh16a1 UTSW 7 44,797,403 (GRCm39) missense probably damaging 1.00
R0532:Aldh16a1 UTSW 7 44,792,262 (GRCm39) missense probably damaging 1.00
R0550:Aldh16a1 UTSW 7 44,795,653 (GRCm39) splice site probably null
R0707:Aldh16a1 UTSW 7 44,793,931 (GRCm39) unclassified probably benign
R0801:Aldh16a1 UTSW 7 44,796,900 (GRCm39) missense probably benign 0.00
R1224:Aldh16a1 UTSW 7 44,791,471 (GRCm39) splice site probably null
R1371:Aldh16a1 UTSW 7 44,796,674 (GRCm39) missense possibly damaging 0.78
R1778:Aldh16a1 UTSW 7 44,796,732 (GRCm39) missense probably damaging 1.00
R2064:Aldh16a1 UTSW 7 44,796,585 (GRCm39) critical splice donor site probably null
R4616:Aldh16a1 UTSW 7 44,798,212 (GRCm39) intron probably benign
R4859:Aldh16a1 UTSW 7 44,796,731 (GRCm39) missense probably benign 0.10
R4928:Aldh16a1 UTSW 7 44,791,385 (GRCm39) missense probably damaging 1.00
R5476:Aldh16a1 UTSW 7 44,791,493 (GRCm39) missense possibly damaging 0.89
R5591:Aldh16a1 UTSW 7 44,794,076 (GRCm39) missense probably null 0.82
R5647:Aldh16a1 UTSW 7 44,803,889 (GRCm39) missense probably benign 0.00
R5692:Aldh16a1 UTSW 7 44,797,223 (GRCm39) missense probably damaging 1.00
R5698:Aldh16a1 UTSW 7 44,803,831 (GRCm39) unclassified probably benign
R5879:Aldh16a1 UTSW 7 44,796,930 (GRCm39) nonsense probably null
R5890:Aldh16a1 UTSW 7 44,793,969 (GRCm39) missense probably benign 0.00
R6321:Aldh16a1 UTSW 7 44,799,189 (GRCm39) missense probably damaging 1.00
R6338:Aldh16a1 UTSW 7 44,791,385 (GRCm39) missense probably damaging 1.00
R6373:Aldh16a1 UTSW 7 44,795,695 (GRCm39) missense probably benign 0.00
R6497:Aldh16a1 UTSW 7 44,794,361 (GRCm39) missense possibly damaging 0.93
R6566:Aldh16a1 UTSW 7 44,792,651 (GRCm39) missense probably benign 0.22
R7248:Aldh16a1 UTSW 7 44,795,018 (GRCm39) missense probably damaging 0.98
R7303:Aldh16a1 UTSW 7 44,797,328 (GRCm39) missense probably damaging 1.00
R7467:Aldh16a1 UTSW 7 44,795,331 (GRCm39) missense probably benign 0.03
R7830:Aldh16a1 UTSW 7 44,795,649 (GRCm39) missense probably damaging 0.98
R8301:Aldh16a1 UTSW 7 44,791,406 (GRCm39) missense possibly damaging 0.80
R8444:Aldh16a1 UTSW 7 44,799,115 (GRCm39) missense probably benign 0.00
R8801:Aldh16a1 UTSW 7 44,791,438 (GRCm39) missense probably benign
R9011:Aldh16a1 UTSW 7 44,794,951 (GRCm39) missense probably damaging 0.98
R9187:Aldh16a1 UTSW 7 44,791,441 (GRCm39) missense probably damaging 0.99
R9620:Aldh16a1 UTSW 7 44,797,413 (GRCm39) nonsense probably null
Z1177:Aldh16a1 UTSW 7 44,795,327 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CCCCATGGGTTTCAGGTATG -3'
(R):5'- GTAGGTAAAGTCTCTGGTGCC -3'

Sequencing Primer
(F):5'- TTTCAGGTATGGCAGGAGC -3'
(R):5'- AGATGGTTGGGGTCCAAG -3'
Posted On 2019-10-24