Mutagenetix > Incidental Mutation

Incidental Mutation 'R7636:Sin3b'

589964

Institutional Source

Beutler Lab

Gene Symbol

Sin3b

Ensembl Gene

ENSMUSG00000031622

Gene Name

transcriptional regulator, SIN3B (yeast)

Synonyms

2810430C10Rik

MMRRC Submission

Accession Numbers

Genbank: NM_009188, NM_001113248; MGI: 107158

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7636 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72723285-72758201 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 72747734 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 549 (K549*)

Ref Sequence

ENSEMBL: ENSMUSP00000004494 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004494]

AlphaFold

Q62141

PDB Structure

STRUCTURE OF THE COMPLEX OF THE MAD1-SIN3B INTERACTION DOMAINS [SOLUTION NMR]
Extended SID of Mad1 bound to the PAH2 domain of mSin3B [SOLUTION NMR]
Solution structure of the first PAH domain of the mouse transcriptional repressor SIN3B [SOLUTION NMR]
Solution structure of the NRSF/REST-mSin3B PAH1 complex [SOLUTION NMR]
Solution structure of free PAH2 domain of mSin3B [SOLUTION NMR]

Predicted Effect

probably null
Transcript: ENSMUST00000004494
AA Change: K549*

SMART Domains

Protein: ENSMUSP00000004494
Gene: ENSMUSG00000031622
AA Change: K549*

Domain	Start	End	E-Value	Type
low complexity region	5	26	N/A	INTRINSIC
Pfam:PAH	53	97	2.5e-19	PFAM
Pfam:PAH	173	227	4.4e-20	PFAM
Pfam:PAH	313	357	1.6e-8	PFAM
HDAC_interact	384	484	2.75e-58	SMART
low complexity region	667	688	N/A	INTRINSIC
Pfam:Sin3a_C	712	1011	7.2e-81	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (55/55)

MGI Phenotype

PHENOTYPE: Homozygous null mice fail to survive past P1 and exhibit pallor, fetal growth retardation, impaired terminal differentiation of erythrocytes and granulocytes, a pale liver and reduced ossification of the long bones in the hindlimb. Mutant MEFs show impaired G0 arrest upon serum deprivation. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted, knock-out(1) Targeted, other(4) Gene trapped(3)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	C	T	16: 17,117,837	E199K	possibly damaging	Het
4932415D10Rik	T	A	10: 82,295,139	D679V	probably benign	Het
Akap13	C	A	7: 75,609,873	N748K	probably benign	Het
Aldh16a1	G	T	7: 45,147,531	P58T	unknown	Het
Amhr2	T	A	15: 102,452,458	C343S	probably damaging	Het
Ankrd17	A	T	5: 90,232,380	M2483K	possibly damaging	Het
Ano3	A	T	2: 110,682,703	L649*	probably null	Het
Apob	T	C	12: 8,009,516	I2666T	possibly damaging	Het
C1ql3	A	T	2: 13,010,810	V13E	probably benign	Het
Casp12	A	G	9: 5,358,344	I384V	probably benign	Het
Clcn1	A	T	6: 42,291,334	K147*	probably null	Het
Ctnna1	T	A	18: 35,223,473	N398K	possibly damaging	Het
Dcdc2a	A	T	13: 25,102,622	K176M	probably damaging	Het
Depdc5	T	A	5: 32,917,983	S502T	probably benign	Het
Fam166a	A	T	2: 25,218,820	H7L	probably damaging	Het
Fam83e	G	A	7: 45,727,026	D388N	probably damaging	Het
Fbxl15	G	A	19: 46,329,175	E99K	probably benign	Het
Fbxw2	T	C	2: 34,812,944	T186A	probably benign	Het
Frem2	T	A	3: 53,653,247	M1280L	probably benign	Het
Gbgt1	T	A	2: 28,505,314	D321E	probably damaging	Het
Gsdmc2	T	A	15: 63,828,192	T244S	probably benign	Het
Heatr5a	C	A	12: 51,888,196	G1675W	probably damaging	Het
Heatr5a	G	A	12: 51,952,558	L287F	probably damaging	Het
Hfm1	C	A	5: 106,917,466	A116S	probably benign	Het
Insr	A	G	8: 3,258,709	I109T	probably damaging	Het
Itga4	A	G	2: 79,313,832	I688V	probably benign	Het
Lipe	A	G	7: 25,388,617	M49T	probably benign	Het
Lrriq3	A	G	3: 155,188,150	Y496C	probably damaging	Het
Lyst	T	C	13: 13,616,747		probably null	Het
Megf10	T	A	18: 57,276,989	I614N	possibly damaging	Het
Mkx	A	G	18: 7,000,630	I104T	possibly damaging	Het
Mrgpra4	C	A	7: 47,980,973	L293F	possibly damaging	Het
Olfm2	A	G	9: 20,668,297	V386A	possibly damaging	Het
Olfr1234	A	T	2: 89,363,239	Y63*	probably null	Het
Olfr317	A	T	11: 58,732,447	N239K	possibly damaging	Het
Olfr605	C	A	7: 103,442,833	D97Y	probably damaging	Het
Pkd2l1	G	T	19: 44,191,431	D113E	possibly damaging	Het
Rab11fip2	A	T	19: 59,942,885	I39K	possibly damaging	Het
Rab1b	A	T	19: 5,100,782	V99E	probably damaging	Het
Rad54l2	A	T	9: 106,720,387	L140Q	probably damaging	Het
Repin1	T	C	6: 48,596,365	F76S	probably benign	Het
Robo1	A	G	16: 72,563,727	D9G		Het
Scn3a	A	G	2: 65,497,689	L819P	probably damaging	Het
Scn7a	A	T	2: 66,743,828	N150K	possibly damaging	Het
Sh2d3c	T	C	2: 32,725,011	S38P	probably benign	Het
Sorl1	A	G	9: 42,092,334	F222S	possibly damaging	Het
Tmem147	A	T	7: 30,728,301		probably null	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tmem179	C	T	12: 112,510,743		probably null	Het
Tubg2	A	T	11: 101,160,087	I213F	probably damaging	Het
Zfhx3	T	C	8: 108,946,809	I1497T	probably benign	Het
Zfp128	A	T	7: 12,890,112	M136L	probably benign	Het
Zzz3	G	A	3: 152,427,652	A116T	probably benign	Het

Other mutations in Sin3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00586:Sin3b	APN	8	72757000	missense	probably benign	0.22
IGL01107:Sin3b	APN	8	72731105	missense	possibly damaging	0.74
IGL01114:Sin3b	APN	8	72744505	missense	probably benign	0.06
IGL01603:Sin3b	APN	8	72750064	missense	probably damaging	1.00
IGL01763:Sin3b	APN	8	72746608	missense	probably damaging	1.00
IGL02078:Sin3b	APN	8	72753580	missense	possibly damaging	0.49
IGL02572:Sin3b	APN	8	72744481	missense	probably benign	0.15
IGL02732:Sin3b	APN	8	72733453	missense	possibly damaging	0.72
IGL02831:Sin3b	APN	8	72744562	missense	probably damaging	1.00
IGL03064:Sin3b	APN	8	72757058	unclassified	probably benign
IGL03107:Sin3b	APN	8	72753585	missense	probably damaging	0.99
IGL03142:Sin3b	APN	8	72744568	missense	probably damaging	1.00
3-1:Sin3b	UTSW	8	72753209	missense	possibly damaging	0.95
R0070:Sin3b	UTSW	8	72725582	missense	probably damaging	1.00
R0070:Sin3b	UTSW	8	72725582	missense	probably damaging	1.00
R0226:Sin3b	UTSW	8	72744508	missense	probably benign	0.44
R0629:Sin3b	UTSW	8	72753536	splice site	probably benign
R1486:Sin3b	UTSW	8	72750513	missense	probably benign	0.00
R1524:Sin3b	UTSW	8	72753287	missense	probably benign	0.05
R1653:Sin3b	UTSW	8	72741519	missense	probably benign	0.30
R2144:Sin3b	UTSW	8	72731265	missense	probably damaging	1.00
R2180:Sin3b	UTSW	8	72753295	nonsense	probably null
R2271:Sin3b	UTSW	8	72733419	missense	probably benign	0.11
R2353:Sin3b	UTSW	8	72724152	critical splice donor site	probably null
R3945:Sin3b	UTSW	8	72733439	missense	possibly damaging	0.88
R4412:Sin3b	UTSW	8	72739779	missense	probably benign	0.16
R4564:Sin3b	UTSW	8	72753581	missense	probably damaging	1.00
R4782:Sin3b	UTSW	8	72725643	missense	probably benign	0.04
R4799:Sin3b	UTSW	8	72725643	missense	probably benign	0.04
R4863:Sin3b	UTSW	8	72744948	missense	possibly damaging	0.91
R5011:Sin3b	UTSW	8	72744556	missense	probably benign	0.39
R5237:Sin3b	UTSW	8	72733343	critical splice acceptor site	probably null
R5325:Sin3b	UTSW	8	72750526	missense	probably damaging	1.00
R5725:Sin3b	UTSW	8	72725692	critical splice donor site	probably null
R5927:Sin3b	UTSW	8	72749878	missense	probably benign	0.00
R5945:Sin3b	UTSW	8	72731165	missense	probably damaging	0.97
R6492:Sin3b	UTSW	8	72733490	critical splice donor site	probably null
R7092:Sin3b	UTSW	8	72747870	critical splice donor site	probably null
R7106:Sin3b	UTSW	8	72724137	missense	possibly damaging	0.90
R7258:Sin3b	UTSW	8	72750208	missense	probably benign	0.00
R7472:Sin3b	UTSW	8	72753225	missense	probably damaging	1.00
R7475:Sin3b	UTSW	8	72749872	missense	possibly damaging	0.47
R7491:Sin3b	UTSW	8	72746441	missense	probably damaging	1.00
R8063:Sin3b	UTSW	8	72725541	missense	probably damaging	1.00
R8354:Sin3b	UTSW	8	72741480	missense	probably benign
R8454:Sin3b	UTSW	8	72741480	missense	probably benign
R8711:Sin3b	UTSW	8	72723398	missense	probably damaging	0.97
R8719:Sin3b	UTSW	8	72723511	missense	unknown
R8807:Sin3b	UTSW	8	72750080	missense	probably benign	0.00
R8857:Sin3b	UTSW	8	72756895	missense	probably benign
R8924:Sin3b	UTSW	8	72746503	missense	probably benign	0.05
R9035:Sin3b	UTSW	8	72723464	missense	unknown
R9127:Sin3b	UTSW	8	72733406	missense	possibly damaging	0.70
R9272:Sin3b	UTSW	8	72744540	missense	probably benign	0.02
R9455:Sin3b	UTSW	8	72724053	missense	possibly damaging	0.56
R9641:Sin3b	UTSW	8	72750559	missense	probably damaging	1.00
X0017:Sin3b	UTSW	8	72731165	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GTTGGCTCTGTAGGACCACTTC -3'
(R):5'- AGGAGATTGGTAGTCCCTGC -3'

Sequencing Primer
(F):5'- TGGCATCGGACTTAACCATG -3'
(R):5'- ATTGGTAGTCCCTGCCCAGC -3'

Posted On

2019-10-24