Incidental Mutation 'R7636:Heatr5a'
ID589975
Institutional Source Beutler Lab
Gene Symbol Heatr5a
Ensembl Gene ENSMUSG00000035181
Gene NameHEAT repeat containing 5A
SynonymsD930036F22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R7636 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location51875871-51971321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 51952558 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 287 (L287F)
Ref Sequence ENSEMBL: ENSMUSP00000043115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040583]
Predicted Effect probably damaging
Transcript: ENSMUST00000040583
AA Change: L287F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043115
Gene: ENSMUSG00000035181
AA Change: L287F

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1qbkb_ 112 658 6e-13 SMART
low complexity region 1063 1078 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1110 1120 N/A INTRINSIC
low complexity region 1122 1135 N/A INTRINSIC
low complexity region 1496 1507 N/A INTRINSIC
low complexity region 1722 1735 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik C T 16: 17,117,837 E199K possibly damaging Het
4932415D10Rik T A 10: 82,295,139 D679V probably benign Het
Akap13 C A 7: 75,609,873 N748K probably benign Het
Aldh16a1 G T 7: 45,147,531 P58T unknown Het
Amhr2 T A 15: 102,452,458 C343S probably damaging Het
Ankrd17 A T 5: 90,232,380 M2483K possibly damaging Het
Ano3 A T 2: 110,682,703 L649* probably null Het
Apob T C 12: 8,009,516 I2666T possibly damaging Het
C1ql3 A T 2: 13,010,810 V13E probably benign Het
Casp12 A G 9: 5,358,344 I384V probably benign Het
Clcn1 A T 6: 42,291,334 K147* probably null Het
Ctnna1 T A 18: 35,223,473 N398K possibly damaging Het
Dcdc2a A T 13: 25,102,622 K176M probably damaging Het
Depdc5 T A 5: 32,917,983 S502T probably benign Het
Fam166a A T 2: 25,218,820 H7L probably damaging Het
Fam83e G A 7: 45,727,026 D388N probably damaging Het
Fbxl15 G A 19: 46,329,175 E99K probably benign Het
Fbxw2 T C 2: 34,812,944 T186A probably benign Het
Frem2 T A 3: 53,653,247 M1280L probably benign Het
Gbgt1 T A 2: 28,505,314 D321E probably damaging Het
Gm4788 A G 1: 139,739,322 V405A probably benign Het
Gsdmc2 T A 15: 63,828,192 T244S probably benign Het
Hfm1 C A 5: 106,917,466 A116S probably benign Het
Insr A G 8: 3,258,709 I109T probably damaging Het
Itga4 A G 2: 79,313,832 I688V probably benign Het
Lipe A G 7: 25,388,617 M49T probably benign Het
Lrriq3 A G 3: 155,188,150 Y496C probably damaging Het
Lyst T C 13: 13,616,747 probably null Het
Megf10 T A 18: 57,276,989 I614N possibly damaging Het
Mkx A G 18: 7,000,630 I104T possibly damaging Het
Mrgpra4 C A 7: 47,980,973 L293F possibly damaging Het
Olfm2 A G 9: 20,668,297 V386A possibly damaging Het
Olfr1234 A T 2: 89,363,239 Y63* probably null Het
Olfr317 A T 11: 58,732,447 N239K possibly damaging Het
Olfr605 C A 7: 103,442,833 D97Y probably damaging Het
Pkd2l1 G T 19: 44,191,431 D113E possibly damaging Het
Rab11fip2 A T 19: 59,942,885 I39K possibly damaging Het
Rab1b A T 19: 5,100,782 V99E probably damaging Het
Rad54l2 A T 9: 106,720,387 L140Q probably damaging Het
Repin1 T C 6: 48,596,365 F76S probably benign Het
Robo1 A G 16: 72,563,727 D9G Het
Scn3a A G 2: 65,497,689 L819P probably damaging Het
Scn7a A T 2: 66,743,828 N150K possibly damaging Het
Sh2d3c T C 2: 32,725,011 S38P probably benign Het
Sin3b A T 8: 72,747,734 K549* probably null Het
Sorl1 A G 9: 42,092,334 F222S possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem179 C T 12: 112,510,743 probably null Het
Tubg2 A T 11: 101,160,087 I213F probably damaging Het
Zfhx3 T C 8: 108,946,809 I1497T probably benign Het
Zfp128 A T 7: 12,890,112 M136L probably benign Het
Zzz3 G A 3: 152,427,652 A116T probably benign Het
Other mutations in Heatr5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Heatr5a APN 12 51888901 missense probably damaging 0.99
IGL01397:Heatr5a APN 12 51894369 missense possibly damaging 0.89
IGL01481:Heatr5a APN 12 51955425 missense probably damaging 1.00
IGL01684:Heatr5a APN 12 51955511 missense probably benign 0.36
IGL01766:Heatr5a APN 12 51889664 missense probably benign 0.15
IGL01799:Heatr5a APN 12 51897835 missense probably benign 0.17
IGL02007:Heatr5a APN 12 51916158 missense probably damaging 1.00
IGL02093:Heatr5a APN 12 51916075 missense possibly damaging 0.68
IGL02205:Heatr5a APN 12 51877337 missense probably damaging 1.00
IGL02450:Heatr5a APN 12 51945430 missense probably benign 0.02
IGL02565:Heatr5a APN 12 51951099 missense possibly damaging 0.54
IGL02707:Heatr5a APN 12 51921366 missense probably benign 0.01
IGL02735:Heatr5a APN 12 51915021 missense probably damaging 0.99
IGL03160:Heatr5a APN 12 51884496 splice site probably benign
F5770:Heatr5a UTSW 12 51881278 splice site probably benign
R0034:Heatr5a UTSW 12 51925172 missense probably damaging 1.00
R0127:Heatr5a UTSW 12 51925405 missense probably benign
R0184:Heatr5a UTSW 12 51909969 missense probably benign 0.00
R0362:Heatr5a UTSW 12 51888861 missense probably damaging 1.00
R0567:Heatr5a UTSW 12 51910089 missense probably damaging 1.00
R0591:Heatr5a UTSW 12 51910101 splice site probably benign
R0736:Heatr5a UTSW 12 51896561 critical splice donor site probably null
R1532:Heatr5a UTSW 12 51952518 missense probably damaging 0.99
R1914:Heatr5a UTSW 12 51905467 missense probably damaging 1.00
R1956:Heatr5a UTSW 12 51945419 critical splice donor site probably null
R1978:Heatr5a UTSW 12 51939658 missense possibly damaging 0.77
R2044:Heatr5a UTSW 12 51955403 missense probably benign 0.19
R2263:Heatr5a UTSW 12 51916150 missense probably damaging 0.97
R2265:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2267:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2268:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2269:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2842:Heatr5a UTSW 12 51955478 missense probably null 1.00
R2842:Heatr5a UTSW 12 51955477 synonymous probably null
R3033:Heatr5a UTSW 12 51951038 nonsense probably null
R4303:Heatr5a UTSW 12 51956225 missense probably benign 0.01
R4675:Heatr5a UTSW 12 51877347 missense probably benign 0.17
R4718:Heatr5a UTSW 12 51916163 missense possibly damaging 0.95
R4807:Heatr5a UTSW 12 51877520 missense probably damaging 1.00
R5114:Heatr5a UTSW 12 51956237 nonsense probably null
R5229:Heatr5a UTSW 12 51947978 missense probably benign 0.33
R5411:Heatr5a UTSW 12 51888243 missense probably damaging 1.00
R5548:Heatr5a UTSW 12 51958951 nonsense probably null
R5603:Heatr5a UTSW 12 51877575 missense probably benign 0.26
R5631:Heatr5a UTSW 12 51955527 missense probably benign 0.22
R5742:Heatr5a UTSW 12 51955552 nonsense probably null
R5969:Heatr5a UTSW 12 51959040 missense probably benign
R6020:Heatr5a UTSW 12 51884327 missense probably benign 0.01
R6234:Heatr5a UTSW 12 51877454 missense possibly damaging 0.69
R6352:Heatr5a UTSW 12 51951166 missense possibly damaging 0.88
R6798:Heatr5a UTSW 12 51881265 missense probably benign 0.01
R6815:Heatr5a UTSW 12 51955508 missense possibly damaging 0.89
R7059:Heatr5a UTSW 12 51888234 missense probably damaging 0.98
R7143:Heatr5a UTSW 12 51961468 missense probably benign 0.09
R7178:Heatr5a UTSW 12 51925142 missense probably damaging 0.99
R7291:Heatr5a UTSW 12 51925339 missense probably damaging 0.97
R7454:Heatr5a UTSW 12 51961543 missense probably benign 0.20
R7511:Heatr5a UTSW 12 51879434 missense possibly damaging 0.94
R7636:Heatr5a UTSW 12 51888196 missense probably damaging 1.00
R7665:Heatr5a UTSW 12 51961530 missense probably damaging 1.00
V7732:Heatr5a UTSW 12 51905324 missense possibly damaging 0.65
Z1088:Heatr5a UTSW 12 51891404 missense probably damaging 1.00
Z1088:Heatr5a UTSW 12 51951076 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GTGAGCAGAATCAGCAACTTCG -3'
(R):5'- TTAGGTTGGTCAGGTCTCCAGC -3'

Sequencing Primer
(F):5'- AACTTCGCACTGTGGAGTCAGATC -3'
(R):5'- ACCTAACCCTTGAGAGACTTGGG -3'
Posted On2019-10-24