Incidental Mutation 'R7636:Megf10'
ID 589986
Institutional Source Beutler Lab
Gene Symbol Megf10
Ensembl Gene ENSMUSG00000024593
Gene Name multiple EGF-like-domains 10
Synonyms LOC240312, 3000002B06Rik
MMRRC Submission 045722-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.237) question?
Stock # R7636 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 57266162-57430539 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 57410061 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 614 (I614N)
Ref Sequence ENSEMBL: ENSMUSP00000075174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]
AlphaFold Q6DIB5
Predicted Effect possibly damaging
Transcript: ENSMUST00000075770
AA Change: I614N

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593
AA Change: I614N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000139892
AA Change: I614N

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593
AA Change: I614N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik C T 16: 16,935,701 (GRCm39) E199K possibly damaging Het
Akap13 C A 7: 75,259,621 (GRCm39) N748K probably benign Het
Aldh16a1 G T 7: 44,796,955 (GRCm39) P58T unknown Het
Amhr2 T A 15: 102,360,893 (GRCm39) C343S probably damaging Het
Ankrd17 A T 5: 90,380,239 (GRCm39) M2483K possibly damaging Het
Ano3 A T 2: 110,513,048 (GRCm39) L649* probably null Het
Apob T C 12: 8,059,516 (GRCm39) I2666T possibly damaging Het
C1ql3 A T 2: 13,015,621 (GRCm39) V13E probably benign Het
Casp12 A G 9: 5,358,344 (GRCm39) I384V probably benign Het
Cimip2a A T 2: 25,108,832 (GRCm39) H7L probably damaging Het
Clcn1 A T 6: 42,268,268 (GRCm39) K147* probably null Het
Ctnna1 T A 18: 35,356,526 (GRCm39) N398K possibly damaging Het
Dcdc2a A T 13: 25,286,605 (GRCm39) K176M probably damaging Het
Depdc5 T A 5: 33,075,327 (GRCm39) S502T probably benign Het
Fam83e G A 7: 45,376,450 (GRCm39) D388N probably damaging Het
Fbxl15 G A 19: 46,317,614 (GRCm39) E99K probably benign Het
Fbxw2 T C 2: 34,702,956 (GRCm39) T186A probably benign Het
Frem2 T A 3: 53,560,668 (GRCm39) M1280L probably benign Het
Gbgt1 T A 2: 28,395,326 (GRCm39) D321E probably damaging Het
Gsdmc2 T A 15: 63,700,041 (GRCm39) T244S probably benign Het
Heatr5a C A 12: 51,934,979 (GRCm39) G1675W probably damaging Het
Heatr5a G A 12: 51,999,341 (GRCm39) L287F probably damaging Het
Hfm1 C A 5: 107,065,332 (GRCm39) A116S probably benign Het
Insr A G 8: 3,308,709 (GRCm39) I109T probably damaging Het
Itga4 A G 2: 79,144,176 (GRCm39) I688V probably benign Het
Lipe A G 7: 25,088,042 (GRCm39) M49T probably benign Het
Lrriq3 A G 3: 154,893,787 (GRCm39) Y496C probably damaging Het
Lyst T C 13: 13,791,332 (GRCm39) probably null Het
Mkx A G 18: 7,000,630 (GRCm39) I104T possibly damaging Het
Mrgpra4 C A 7: 47,630,721 (GRCm39) L293F possibly damaging Het
Olfm2 A G 9: 20,579,593 (GRCm39) V386A possibly damaging Het
Or2w3b A T 11: 58,623,273 (GRCm39) N239K possibly damaging Het
Or4a15 A T 2: 89,193,583 (GRCm39) Y63* probably null Het
Or52s6 C A 7: 103,092,040 (GRCm39) D97Y probably damaging Het
Pkd2l1 G T 19: 44,179,870 (GRCm39) D113E possibly damaging Het
Rab11fip2 A T 19: 59,931,317 (GRCm39) I39K possibly damaging Het
Rab1b A T 19: 5,150,810 (GRCm39) V99E probably damaging Het
Rad54l2 A T 9: 106,597,586 (GRCm39) L140Q probably damaging Het
Repin1 T C 6: 48,573,299 (GRCm39) F76S probably benign Het
Robo1 A G 16: 72,360,615 (GRCm39) D9G Het
Scn3a A G 2: 65,328,033 (GRCm39) L819P probably damaging Het
Scn7a A T 2: 66,574,172 (GRCm39) N150K possibly damaging Het
Sh2d3c T C 2: 32,615,023 (GRCm39) S38P probably benign Het
Sin3b A T 8: 73,474,362 (GRCm39) K549* probably null Het
Sorl1 A G 9: 42,003,630 (GRCm39) F222S possibly damaging Het
Spata31h1 T A 10: 82,130,973 (GRCm39) D679V probably benign Het
Tmem147 A T 7: 30,427,726 (GRCm39) probably null Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Tmem179 C T 12: 112,477,177 (GRCm39) probably null Het
Tubg2 A T 11: 101,050,913 (GRCm39) I213F probably damaging Het
Zfhx3 T C 8: 109,673,441 (GRCm39) I1497T probably benign Het
Zfp128 A T 7: 12,624,039 (GRCm39) M136L probably benign Het
Zzz3 G A 3: 152,133,289 (GRCm39) A116T probably benign Het
Other mutations in Megf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Megf10 APN 18 57,373,700 (GRCm39) missense probably damaging 1.00
IGL00736:Megf10 APN 18 57,425,782 (GRCm39) missense probably benign 0.35
IGL01631:Megf10 APN 18 57,392,869 (GRCm39) missense possibly damaging 0.61
IGL02488:Megf10 APN 18 57,425,704 (GRCm39) missense probably damaging 1.00
IGL02747:Megf10 APN 18 57,423,565 (GRCm39) missense probably benign 0.43
IGL03298:Megf10 APN 18 57,416,910 (GRCm39) nonsense probably null
deep UTSW 18 57,395,203 (GRCm39) missense probably damaging 1.00
megalodon UTSW 18 57,421,048 (GRCm39) nonsense probably null
sharkie UTSW 18 57,324,257 (GRCm39) nonsense probably null
IGL03046:Megf10 UTSW 18 57,421,055 (GRCm39) missense possibly damaging 0.95
PIT4696001:Megf10 UTSW 18 57,410,760 (GRCm39) missense probably damaging 1.00
R0020:Megf10 UTSW 18 57,420,965 (GRCm39) missense possibly damaging 0.81
R0020:Megf10 UTSW 18 57,420,965 (GRCm39) missense possibly damaging 0.81
R0115:Megf10 UTSW 18 57,392,874 (GRCm39) missense possibly damaging 0.67
R0455:Megf10 UTSW 18 57,386,054 (GRCm39) missense probably benign 0.34
R0602:Megf10 UTSW 18 57,395,172 (GRCm39) missense probably damaging 0.98
R0630:Megf10 UTSW 18 57,421,067 (GRCm39) missense probably benign 0.14
R0652:Megf10 UTSW 18 57,410,796 (GRCm39) missense probably benign 0.00
R0658:Megf10 UTSW 18 57,385,968 (GRCm39) missense probably benign 0.00
R0761:Megf10 UTSW 18 57,421,048 (GRCm39) nonsense probably null
R1013:Megf10 UTSW 18 57,394,291 (GRCm39) missense probably benign 0.00
R1130:Megf10 UTSW 18 57,395,078 (GRCm39) missense probably benign 0.06
R1451:Megf10 UTSW 18 57,385,931 (GRCm39) missense probably damaging 0.97
R1699:Megf10 UTSW 18 57,410,802 (GRCm39) splice site probably null
R1729:Megf10 UTSW 18 57,373,864 (GRCm39) critical splice donor site probably null
R1784:Megf10 UTSW 18 57,373,864 (GRCm39) critical splice donor site probably null
R1870:Megf10 UTSW 18 57,324,257 (GRCm39) nonsense probably null
R1961:Megf10 UTSW 18 57,345,426 (GRCm39) missense probably damaging 0.97
R2094:Megf10 UTSW 18 57,414,785 (GRCm39) nonsense probably null
R2213:Megf10 UTSW 18 57,421,081 (GRCm39) nonsense probably null
R2853:Megf10 UTSW 18 57,427,003 (GRCm39) missense probably damaging 1.00
R3772:Megf10 UTSW 18 57,416,934 (GRCm39) missense probably benign 0.39
R3774:Megf10 UTSW 18 57,410,177 (GRCm39) missense probably damaging 1.00
R3775:Megf10 UTSW 18 57,410,177 (GRCm39) missense probably damaging 1.00
R3776:Megf10 UTSW 18 57,410,177 (GRCm39) missense probably damaging 1.00
R3858:Megf10 UTSW 18 57,408,907 (GRCm39) splice site probably benign
R3911:Megf10 UTSW 18 57,422,465 (GRCm39) missense probably damaging 0.99
R3966:Megf10 UTSW 18 57,313,646 (GRCm39) missense probably damaging 1.00
R4043:Megf10 UTSW 18 57,392,870 (GRCm39) missense probably damaging 0.98
R4131:Megf10 UTSW 18 57,313,607 (GRCm39) missense probably damaging 1.00
R4598:Megf10 UTSW 18 57,420,884 (GRCm39) missense probably damaging 1.00
R4598:Megf10 UTSW 18 57,322,675 (GRCm39) critical splice donor site probably null
R4726:Megf10 UTSW 18 57,420,864 (GRCm39) missense probably benign 0.32
R4765:Megf10 UTSW 18 57,420,866 (GRCm39) missense possibly damaging 0.56
R4874:Megf10 UTSW 18 57,426,930 (GRCm39) missense probably benign 0.00
R4928:Megf10 UTSW 18 57,373,745 (GRCm39) missense probably benign
R5412:Megf10 UTSW 18 57,324,219 (GRCm39) missense probably damaging 0.99
R5901:Megf10 UTSW 18 57,410,180 (GRCm39) missense probably benign 0.11
R6015:Megf10 UTSW 18 57,386,100 (GRCm39) missense probably benign 0.01
R6036:Megf10 UTSW 18 57,375,799 (GRCm39) missense probably damaging 1.00
R6036:Megf10 UTSW 18 57,375,799 (GRCm39) missense probably damaging 1.00
R6041:Megf10 UTSW 18 57,313,621 (GRCm39) missense probably benign
R6369:Megf10 UTSW 18 57,394,259 (GRCm39) missense probably benign 0.06
R6479:Megf10 UTSW 18 57,379,642 (GRCm39) missense possibly damaging 0.76
R6489:Megf10 UTSW 18 57,424,879 (GRCm39) missense probably benign 0.01
R7228:Megf10 UTSW 18 57,322,661 (GRCm39) missense probably damaging 1.00
R7296:Megf10 UTSW 18 57,408,825 (GRCm39) missense probably damaging 1.00
R7437:Megf10 UTSW 18 57,395,203 (GRCm39) missense probably damaging 1.00
R7461:Megf10 UTSW 18 57,385,925 (GRCm39) missense probably damaging 0.98
R7488:Megf10 UTSW 18 57,324,187 (GRCm39) missense probably damaging 0.99
R7492:Megf10 UTSW 18 57,424,866 (GRCm39) missense probably benign 0.00
R7542:Megf10 UTSW 18 57,322,642 (GRCm39) missense probably benign 0.07
R7646:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7650:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7713:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7714:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7716:Megf10 UTSW 18 57,427,071 (GRCm39) unclassified probably benign
R7796:Megf10 UTSW 18 57,410,731 (GRCm39) missense possibly damaging 0.85
R7915:Megf10 UTSW 18 57,373,807 (GRCm39) missense probably benign 0.05
R8221:Megf10 UTSW 18 57,416,893 (GRCm39) missense probably benign 0.00
R8527:Megf10 UTSW 18 57,425,790 (GRCm39) missense probably benign 0.00
R8559:Megf10 UTSW 18 57,373,699 (GRCm39) missense probably damaging 1.00
R9117:Megf10 UTSW 18 57,392,773 (GRCm39) missense probably damaging 1.00
R9337:Megf10 UTSW 18 57,394,252 (GRCm39) nonsense probably null
R9481:Megf10 UTSW 18 57,395,090 (GRCm39) missense probably benign 0.38
R9644:Megf10 UTSW 18 57,375,773 (GRCm39) missense probably benign
RF003:Megf10 UTSW 18 57,427,099 (GRCm39) unclassified probably benign
Z1176:Megf10 UTSW 18 57,410,766 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGGTATACGGAAGACATCCC -3'
(R):5'- AGTACAGACCTAAGGAAGCTTGAC -3'

Sequencing Primer
(F):5'- GGTATACGGAAGACATCCCCTCAC -3'
(R):5'- GAAGCTTGACCTTCCCCATGG -3'
Posted On 2019-10-24