Incidental Mutation 'R7637:Wnt10a'
ID589992
Institutional Source Beutler Lab
Gene Symbol Wnt10a
Ensembl Gene ENSMUSG00000026167
Gene Namewingless-type MMTV integration site family, member 10A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7637 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location74791516-74804179 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 74793474 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 75 (C75*)
Ref Sequence ENSEMBL: ENSMUSP00000006718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006718]
Predicted Effect probably null
Transcript: ENSMUST00000006718
AA Change: C75*
SMART Domains Protein: ENSMUSP00000006718
Gene: ENSMUSG00000026167
AA Change: C75*

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
WNT1 63 417 4.97e-143 SMART
Predicted Effect probably null
Transcript: ENSMUST00000187238
AA Change: C37*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is strongly expressed in the cell lines of promyelocytic leukemia and Burkitt's lymphoma. In addition, it and another family member, the WNT6 gene, are strongly coexpressed in colorectal cancer cell lines. The gene overexpression may play key roles in carcinogenesis through activation of the WNT-beta-catenin-TCF signaling pathway. This gene and the WNT6 gene are clustered in the chromosome 2q35 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit taurodontism, supernumerary molars, small molars and misshapened crowns. Mice homozygous for a conditional allele activated in Krt14+ cells also exhibit decreased basal cell proliferation affecting the tongue, sweat glands and nails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,218,952 Q651L probably benign Het
Adam8 C T 7: 139,985,430 V624I probably damaging Het
Ccdc144b T A 3: 36,046,876 Q49L probably damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Cmya5 T C 13: 93,083,212 K3243R possibly damaging Het
Dock5 G A 14: 67,786,340 T1124M possibly damaging Het
Fam8a1 A T 13: 46,671,247 M237L probably benign Het
Fars2 G T 13: 36,204,775 K82N probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm5767 C T 16: 8,683,646 P59L unknown Het
Gnat3 A G 5: 18,003,772 D158G Het
Grhl2 A C 15: 37,328,330 N400T probably damaging Het
Grin2c A T 11: 115,256,259 probably null Het
Hipk4 A G 7: 27,523,548 Y11C probably damaging Het
Hspa9 G T 18: 34,938,687 A620E not run Het
Igkv12-89 A G 6: 68,835,099 S29P probably benign Het
Itga8 A T 2: 12,109,187 D1039E probably damaging Het
Itgae A T 11: 73,113,631 D248V probably damaging Het
Kmt2c T C 5: 25,315,095 K2006E probably damaging Het
Mdga1 C T 17: 29,832,379 G934R probably benign Het
Mov10 T C 3: 104,795,885 N896S probably benign Het
Ndufb6 A T 4: 40,273,080 probably null Het
Nlk T C 11: 78,591,005 probably null Het
Notch2 T A 3: 98,146,623 S2201T probably damaging Het
Olfr152 A T 2: 87,783,434 D298V probably damaging Het
Pank1 A C 19: 34,821,988 probably null Het
Pdlim3 T C 8: 45,909,065 F126S probably damaging Het
Pds5a C A 5: 65,638,604 G648C probably benign Het
Plekhh3 T C 11: 101,164,327 I567V unknown Het
Ppfia2 T C 10: 106,865,403 probably null Het
Prl3d1 A G 13: 27,100,069 D207G probably damaging Het
Prss23 T A 7: 89,510,246 D205V probably benign Het
Pygl C T 12: 70,197,795 probably null Het
Qsox2 A G 2: 26,221,020 F111S probably damaging Het
Sart3 T C 5: 113,771,352 N95S probably benign Het
Scpep1 A G 11: 88,929,220 F414S probably damaging Het
Selenbp1 C A 3: 94,937,348 Y105* probably null Het
Sirpa A G 2: 129,616,445 D327G probably benign Het
Sowahc G A 10: 59,222,183 R47H probably damaging Het
Szt2 T C 4: 118,393,828 Y361C probably damaging Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tie1 T C 4: 118,472,978 I1042M probably damaging Het
Tmem132e T A 11: 82,434,516 L114Q probably damaging Het
Tmx3 A G 18: 90,537,109 T317A probably damaging Het
Tppp3 A G 8: 105,468,292 V69A probably benign Het
Tpr T C 1: 150,423,516 Y1156H probably damaging Het
Trank1 A C 9: 111,365,296 D796A possibly damaging Het
Tsc2 G A 17: 24,607,492 P928S probably benign Het
Unc80 G T 1: 66,672,684 V2722F possibly damaging Het
Vmn1r199 G T 13: 22,382,675 L46F probably benign Het
Vps13a A T 19: 16,750,149 H196Q probably benign Het
Zfp335 A G 2: 164,892,539 probably null Het
Other mutations in Wnt10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0347:Wnt10a UTSW 1 74793543 missense probably damaging 0.97
R2312:Wnt10a UTSW 1 74803430 missense possibly damaging 0.74
R3941:Wnt10a UTSW 1 74803497 splice site probably null
R4683:Wnt10a UTSW 1 74803137 missense unknown
R4719:Wnt10a UTSW 1 74803603 missense probably damaging 1.00
R5218:Wnt10a UTSW 1 74793595 missense probably benign
R5244:Wnt10a UTSW 1 74803295 missense probably damaging 0.99
R5813:Wnt10a UTSW 1 74800596 missense probably damaging 1.00
R6652:Wnt10a UTSW 1 74803454 splice site probably null
R7278:Wnt10a UTSW 1 74793482 missense possibly damaging 0.92
R8293:Wnt10a UTSW 1 74803217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGAGTGATTACGGCCTG -3'
(R):5'- AGCTAGCAAGTTTGGGATGG -3'

Sequencing Primer
(F):5'- TGTGTGTTATTAAACAGGCCCTCAC -3'
(R):5'- AGCAAGTTTGGGATGGGGGTG -3'
Posted On2019-10-24