Incidental Mutation 'R7637:Olfr152'
ID589997
Institutional Source Beutler Lab
Gene Symbol Olfr152
Ensembl Gene ENSMUSG00000068816
Gene Nameolfactory receptor 152
SynonymsV1, MOR181-1, GA_x6K02T2Q125-49283184-49284128, Olfr4-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R7637 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87779483-87784572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87783434 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 298 (D298V)
Ref Sequence ENSEMBL: ENSMUSP00000100845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090709] [ENSMUST00000105210] [ENSMUST00000215394]
Predicted Effect probably damaging
Transcript: ENSMUST00000090709
AA Change: D300V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088211
Gene: ENSMUSG00000068816
AA Change: D300V

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 4.3e-49 PFAM
Pfam:7tm_1 45 314 7.9e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105210
AA Change: D298V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100845
Gene: ENSMUSG00000068816
AA Change: D298V

DomainStartEndE-ValueType
Pfam:7tm_1 43 292 6.4e-28 PFAM
Pfam:7tm_4 141 285 1.3e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215394
AA Change: D298V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5393 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,218,952 Q651L probably benign Het
Adam8 C T 7: 139,985,430 V624I probably damaging Het
Ccdc144b T A 3: 36,046,876 Q49L probably damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Cmya5 T C 13: 93,083,212 K3243R possibly damaging Het
Dock5 G A 14: 67,786,340 T1124M possibly damaging Het
Fam8a1 A T 13: 46,671,247 M237L probably benign Het
Fars2 G T 13: 36,204,775 K82N probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm5767 C T 16: 8,683,646 P59L unknown Het
Gnat3 A G 5: 18,003,772 D158G Het
Grhl2 A C 15: 37,328,330 N400T probably damaging Het
Grin2c A T 11: 115,256,259 probably null Het
Hipk4 A G 7: 27,523,548 Y11C probably damaging Het
Hspa9 G T 18: 34,938,687 A620E not run Het
Igkv12-89 A G 6: 68,835,099 S29P probably benign Het
Itga8 A T 2: 12,109,187 D1039E probably damaging Het
Itgae A T 11: 73,113,631 D248V probably damaging Het
Kmt2c T C 5: 25,315,095 K2006E probably damaging Het
Mdga1 C T 17: 29,832,379 G934R probably benign Het
Mov10 T C 3: 104,795,885 N896S probably benign Het
Ndufb6 A T 4: 40,273,080 probably null Het
Nlk T C 11: 78,591,005 probably null Het
Notch2 T A 3: 98,146,623 S2201T probably damaging Het
Pank1 A C 19: 34,821,988 probably null Het
Pdlim3 T C 8: 45,909,065 F126S probably damaging Het
Pds5a C A 5: 65,638,604 G648C probably benign Het
Plekhh3 T C 11: 101,164,327 I567V unknown Het
Ppfia2 T C 10: 106,865,403 probably null Het
Prl3d1 A G 13: 27,100,069 D207G probably damaging Het
Prss23 T A 7: 89,510,246 D205V probably benign Het
Pygl C T 12: 70,197,795 probably null Het
Qsox2 A G 2: 26,221,020 F111S probably damaging Het
Sart3 T C 5: 113,771,352 N95S probably benign Het
Scpep1 A G 11: 88,929,220 F414S probably damaging Het
Selenbp1 C A 3: 94,937,348 Y105* probably null Het
Sirpa A G 2: 129,616,445 D327G probably benign Het
Sowahc G A 10: 59,222,183 R47H probably damaging Het
Szt2 T C 4: 118,393,828 Y361C probably damaging Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tie1 T C 4: 118,472,978 I1042M probably damaging Het
Tmem132e T A 11: 82,434,516 L114Q probably damaging Het
Tmx3 A G 18: 90,537,109 T317A probably damaging Het
Tppp3 A G 8: 105,468,292 V69A probably benign Het
Tpr T C 1: 150,423,516 Y1156H probably damaging Het
Trank1 A C 9: 111,365,296 D796A possibly damaging Het
Tsc2 G A 17: 24,607,492 P928S probably benign Het
Unc80 G T 1: 66,672,684 V2722F possibly damaging Het
Vmn1r199 G T 13: 22,382,675 L46F probably benign Het
Vps13a A T 19: 16,750,149 H196Q probably benign Het
Wnt10a T A 1: 74,793,474 C75* probably null Het
Zfp335 A G 2: 164,892,539 probably null Het
Other mutations in Olfr152
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Olfr152 APN 2 87782539 missense probably benign
IGL01124:Olfr152 APN 2 87783376 missense probably benign 0.01
IGL01383:Olfr152 APN 2 87782873 missense possibly damaging 0.92
IGL01501:Olfr152 APN 2 87783136 missense possibly damaging 0.85
IGL02279:Olfr152 APN 2 87783232 missense probably damaging 0.99
R0141:Olfr152 UTSW 2 87782705 missense possibly damaging 0.74
R0212:Olfr152 UTSW 2 87783482 missense unknown
R0492:Olfr152 UTSW 2 87782822 missense probably damaging 1.00
R1611:Olfr152 UTSW 2 87782624 missense probably benign 0.38
R1697:Olfr152 UTSW 2 87782585 missense possibly damaging 0.95
R3606:Olfr152 UTSW 2 87783207 missense probably benign 0.26
R4583:Olfr152 UTSW 2 87783221 missense possibly damaging 0.76
R4646:Olfr152 UTSW 2 87783221 missense possibly damaging 0.76
R4648:Olfr152 UTSW 2 87783221 missense possibly damaging 0.76
R4853:Olfr152 UTSW 2 87783182 missense probably benign 0.04
R6102:Olfr152 UTSW 2 87782848 missense probably damaging 1.00
R6154:Olfr152 UTSW 2 87782756 missense possibly damaging 0.94
R8306:Olfr152 UTSW 2 87783486 makesense probably null
Z1088:Olfr152 UTSW 2 87782628 missense probably damaging 1.00
Z1176:Olfr152 UTSW 2 87783024 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCGCTCTACAAGTGGGAG -3'
(R):5'- CCATGAGTTGGGATTATGAAATGC -3'

Sequencing Primer
(F):5'- GAAAACCTTCTCCACGTGTGC -3'
(R):5'- GTTGGGATTATGAAATGCATTTGAC -3'
Posted On2019-10-24