Incidental Mutation 'R7637:Ccdc144b'
ID590000
Institutional Source Beutler Lab
Gene Symbol Ccdc144b
Ensembl Gene ENSMUSG00000047696
Gene Namecoiled-coil domain containing 144B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7637 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location36007244-36053547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36046876 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 49 (Q49L)
Ref Sequence ENSEMBL: ENSMUSP00000142910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166644] [ENSMUST00000196964] [ENSMUST00000200469]
Predicted Effect probably damaging
Transcript: ENSMUST00000166644
AA Change: Q49L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132995
Gene: ENSMUSG00000047696
AA Change: Q49L

DomainStartEndE-ValueType
coiled coil region 65 97 N/A INTRINSIC
coiled coil region 121 166 N/A INTRINSIC
coiled coil region 231 327 N/A INTRINSIC
Pfam:DUF3496 381 488 1.6e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196964
AA Change: Q49L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142406
Gene: ENSMUSG00000047696
AA Change: Q49L

DomainStartEndE-ValueType
coiled coil region 65 97 N/A INTRINSIC
coiled coil region 121 166 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200469
AA Change: Q49L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142910
Gene: ENSMUSG00000047696
AA Change: Q49L

DomainStartEndE-ValueType
coiled coil region 65 97 N/A INTRINSIC
coiled coil region 121 166 N/A INTRINSIC
coiled coil region 231 327 N/A INTRINSIC
Pfam:DUF3496 381 488 1.6e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,218,952 Q651L probably benign Het
Adam8 C T 7: 139,985,430 V624I probably damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Cmya5 T C 13: 93,083,212 K3243R possibly damaging Het
Dock5 G A 14: 67,786,340 T1124M possibly damaging Het
Fam8a1 A T 13: 46,671,247 M237L probably benign Het
Fars2 G T 13: 36,204,775 K82N probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm5767 C T 16: 8,683,646 P59L unknown Het
Gnat3 A G 5: 18,003,772 D158G Het
Grhl2 A C 15: 37,328,330 N400T probably damaging Het
Grin2c A T 11: 115,256,259 probably null Het
Hipk4 A G 7: 27,523,548 Y11C probably damaging Het
Hspa9 G T 18: 34,938,687 A620E not run Het
Igkv12-89 A G 6: 68,835,099 S29P probably benign Het
Itga8 A T 2: 12,109,187 D1039E probably damaging Het
Itgae A T 11: 73,113,631 D248V probably damaging Het
Kmt2c T C 5: 25,315,095 K2006E probably damaging Het
Mdga1 C T 17: 29,832,379 G934R probably benign Het
Mov10 T C 3: 104,795,885 N896S probably benign Het
Ndufb6 A T 4: 40,273,080 probably null Het
Nlk T C 11: 78,591,005 probably null Het
Notch2 T A 3: 98,146,623 S2201T probably damaging Het
Olfr152 A T 2: 87,783,434 D298V probably damaging Het
Pank1 A C 19: 34,821,988 probably null Het
Pdlim3 T C 8: 45,909,065 F126S probably damaging Het
Pds5a C A 5: 65,638,604 G648C probably benign Het
Plekhh3 T C 11: 101,164,327 I567V unknown Het
Ppfia2 T C 10: 106,865,403 probably null Het
Prl3d1 A G 13: 27,100,069 D207G probably damaging Het
Prss23 T A 7: 89,510,246 D205V probably benign Het
Pygl C T 12: 70,197,795 probably null Het
Qsox2 A G 2: 26,221,020 F111S probably damaging Het
Sart3 T C 5: 113,771,352 N95S probably benign Het
Scpep1 A G 11: 88,929,220 F414S probably damaging Het
Selenbp1 C A 3: 94,937,348 Y105* probably null Het
Sirpa A G 2: 129,616,445 D327G probably benign Het
Sowahc G A 10: 59,222,183 R47H probably damaging Het
Szt2 T C 4: 118,393,828 Y361C probably damaging Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tie1 T C 4: 118,472,978 I1042M probably damaging Het
Tmem132e T A 11: 82,434,516 L114Q probably damaging Het
Tmx3 A G 18: 90,537,109 T317A probably damaging Het
Tppp3 A G 8: 105,468,292 V69A probably benign Het
Tpr T C 1: 150,423,516 Y1156H probably damaging Het
Trank1 A C 9: 111,365,296 D796A possibly damaging Het
Tsc2 G A 17: 24,607,492 P928S probably benign Het
Unc80 G T 1: 66,672,684 V2722F possibly damaging Het
Vmn1r199 G T 13: 22,382,675 L46F probably benign Het
Vps13a A T 19: 16,750,149 H196Q probably benign Het
Wnt10a T A 1: 74,793,474 C75* probably null Het
Zfp335 A G 2: 164,892,539 probably null Het
Other mutations in Ccdc144b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Ccdc144b APN 3 36019989 missense probably damaging 1.00
IGL00773:Ccdc144b APN 3 36035337 missense probably damaging 1.00
IGL01409:Ccdc144b APN 3 36025928 missense possibly damaging 0.77
IGL01791:Ccdc144b APN 3 36035267 critical splice donor site probably benign 0.00
IGL02307:Ccdc144b APN 3 36018867 missense possibly damaging 0.95
IGL02374:Ccdc144b APN 3 36019959 missense possibly damaging 0.83
IGL02673:Ccdc144b APN 3 36046699 splice site probably benign
IGL02727:Ccdc144b APN 3 36032916 missense possibly damaging 0.66
R0355:Ccdc144b UTSW 3 36046905 splice site probably benign
R0833:Ccdc144b UTSW 3 36020213 splice site probably benign
R0928:Ccdc144b UTSW 3 36025366 missense possibly damaging 0.83
R1595:Ccdc144b UTSW 3 36018997 missense probably damaging 0.99
R1598:Ccdc144b UTSW 3 36018997 missense probably damaging 0.99
R2011:Ccdc144b UTSW 3 36010678 nonsense probably null
R2255:Ccdc144b UTSW 3 36019950 missense probably benign 0.00
R2921:Ccdc144b UTSW 3 36025928 missense probably null 0.01
R4659:Ccdc144b UTSW 3 36025954 missense possibly damaging 0.90
R4764:Ccdc144b UTSW 3 36010660 makesense probably null
R4929:Ccdc144b UTSW 3 36035338 missense probably damaging 0.99
R5631:Ccdc144b UTSW 3 36046877 missense probably damaging 0.99
R5755:Ccdc144b UTSW 3 36017693 missense probably benign
R5849:Ccdc144b UTSW 3 36032877 missense possibly damaging 0.81
R5894:Ccdc144b UTSW 3 36019975 missense possibly damaging 0.91
R5968:Ccdc144b UTSW 3 36010691 missense probably benign 0.00
R6961:Ccdc144b UTSW 3 36050617 missense possibly damaging 0.66
R6963:Ccdc144b UTSW 3 36050662 missense probably benign 0.30
R7248:Ccdc144b UTSW 3 36025937 missense probably benign 0.00
R7380:Ccdc144b UTSW 3 36025921 missense possibly damaging 0.68
R7462:Ccdc144b UTSW 3 36025906 splice site probably null
R7612:Ccdc144b UTSW 3 36025357 missense possibly damaging 0.79
R8025:Ccdc144b UTSW 3 36018987 missense probably damaging 0.97
R8269:Ccdc144b UTSW 3 36046713 missense possibly damaging 0.89
X0011:Ccdc144b UTSW 3 36025948 missense possibly damaging 0.66
X0057:Ccdc144b UTSW 3 36018901 nonsense probably null
Z1176:Ccdc144b UTSW 3 36018888 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TAAGCTGTCCCTGTAACTGCC -3'
(R):5'- GGATGCAAACTCGATTTTCCTC -3'

Sequencing Primer
(F):5'- GGAGCTGACGTCATACCTTACATTG -3'
(R):5'- AAACTCGATTTTCCTCCCCCAG -3'
Posted On2019-10-24