Mutagenetix > Incidental Mutations

Incidental Mutation 'R7637:Notch2'

590002

Institutional Source

Beutler Lab

Gene Symbol

Notch2

Ensembl Gene

ENSMUSG00000027878

Gene Name

notch 2

Synonyms

N2, Motch B

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7637 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

98013527-98150361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 98146623 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 2201 (S2201T)

Ref Sequence

ENSEMBL: ENSMUSP00000078741 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079812]

Predicted Effect

probably damaging
Transcript: ENSMUST00000079812
AA Change: S2201T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000078741
Gene: ENSMUSG00000027878
AA Change: S2201T

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	27	63	5.79e-2	SMART
EGF	67	102	1.54e-6	SMART
EGF	108	143	6.25e-7	SMART
EGF	147	180	5.28e-5	SMART
EGF_CA	182	219	6.14e-15	SMART
EGF	224	258	5.08e-7	SMART
EGF_CA	260	296	1.95e-8	SMART
EGF_CA	298	336	3.91e-8	SMART
EGF_CA	338	374	7.69e-7	SMART
EGF	378	413	6.86e-4	SMART
EGF_CA	415	454	4.15e-12	SMART
EGF_CA	456	492	3.24e-14	SMART
EGF_CA	494	530	4.77e-12	SMART
EGF_CA	532	568	2.04e-11	SMART
EGF_CA	570	605	1.18e-7	SMART
EGF_CA	607	643	7.12e-11	SMART
EGF_CA	645	680	1.82e-8	SMART
EGF_CA	682	718	1.42e-10	SMART
EGF_CA	720	755	1.25e-6	SMART
EGF_CA	757	793	3.61e-12	SMART
EGF_CA	795	831	1.53e-10	SMART
EGF	836	871	1.34e-6	SMART
EGF_CA	873	909	6.05e-14	SMART
EGF_CA	911	947	9.54e-12	SMART
EGF_CA	949	985	1.39e-13	SMART
EGF_CA	987	1023	1.26e-11	SMART
EGF_CA	1025	1061	9.31e-15	SMART
EGF	1066	1099	1.39e-4	SMART
EGF	1104	1147	2.6e-4	SMART
EGF_CA	1149	1185	1.55e-11	SMART
EGF_CA	1187	1223	2.74e-12	SMART
EGF_CA	1225	1262	4.15e-12	SMART
EGF	1267	1302	1.43e-1	SMART
EGF	1307	1343	2.33e-6	SMART
EGF	1377	1412	9.85e-5	SMART
NL	1418	1456	8.55e-19	SMART
NL	1459	1497	2.27e-14	SMART
NL	1498	1535	1.16e-11	SMART
NOD	1539	1595	3.4e-28	SMART
NODP	1619	1679	1.66e-22	SMART
transmembrane domain	1680	1702	N/A	INTRINSIC
ANK	1828	1872	2.18e2	SMART
ANK	1877	1906	3.36e-2	SMART
ANK	1910	1940	1.81e2	SMART
ANK	1944	1973	6.61e-1	SMART
ANK	1977	2006	5.24e-4	SMART
ANK	2010	2039	3.41e-3	SMART
low complexity region	2179	2193	N/A	INTRINSIC
low complexity region	2232	2241	N/A	INTRINSIC
DUF3454	2382	2447	4.62e-30	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Notch family. Members of this Type 1 transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple, different domain types. Notch family members play a role in a variety of developmental processes by controlling cell fate decisions. The Notch signaling network is an evolutionarily conserved intercellular signaling pathway which regulates interactions between physically adjacent cells. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signaling pathway that plays a key role in development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remain to be determined. This protein is cleaved in the trans-Golgi network, and presented on the cell surface as a heterodimer. This protein functions as a receptor for membrane bound ligands, and may play a role in vascular, renal and hepatic development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in embryonic or neonatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	A	11: 110,218,952	Q651L	probably benign	Het
Adam8	C	T	7: 139,985,430	V624I	probably damaging	Het
Ccdc144b	T	A	3: 36,046,876	Q49L	probably damaging	Het
Cltc	T	C	11: 86,730,332	H287R	probably damaging	Het
Cmya5	T	C	13: 93,083,212	K3243R	possibly damaging	Het
Dock5	G	A	14: 67,786,340	T1124M	possibly damaging	Het
Fam8a1	A	T	13: 46,671,247	M237L	probably benign	Het
Fars2	G	T	13: 36,204,775	K82N	probably benign	Het
Gm40460	ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	7: 142,240,713		probably benign	Het
Gm5767	C	T	16: 8,683,646	P59L	unknown	Het
Gnat3	A	G	5: 18,003,772	D158G		Het
Grhl2	A	C	15: 37,328,330	N400T	probably damaging	Het
Grin2c	A	T	11: 115,256,259		probably null	Het
Hipk4	A	G	7: 27,523,548	Y11C	probably damaging	Het
Hspa9	G	T	18: 34,938,687	A620E	not run	Het
Igkv12-89	A	G	6: 68,835,099	S29P	probably benign	Het
Itga8	A	T	2: 12,109,187	D1039E	probably damaging	Het
Itgae	A	T	11: 73,113,631	D248V	probably damaging	Het
Kmt2c	T	C	5: 25,315,095	K2006E	probably damaging	Het
Mdga1	C	T	17: 29,832,379	G934R	probably benign	Het
Mov10	T	C	3: 104,795,885	N896S	probably benign	Het
Ndufb6	A	T	4: 40,273,080		probably null	Het
Nlk	T	C	11: 78,591,005		probably null	Het
Olfr152	A	T	2: 87,783,434	D298V	probably damaging	Het
Pank1	A	C	19: 34,821,988		probably null	Het
Pdlim3	T	C	8: 45,909,065	F126S	probably damaging	Het
Pds5a	C	A	5: 65,638,604	G648C	probably benign	Het
Plekhh3	T	C	11: 101,164,327	I567V	unknown	Het
Ppfia2	T	C	10: 106,865,403		probably null	Het
Prl3d1	A	G	13: 27,100,069	D207G	probably damaging	Het
Prss23	T	A	7: 89,510,246	D205V	probably benign	Het
Pygl	C	T	12: 70,197,795		probably null	Het
Qsox2	A	G	2: 26,221,020	F111S	probably damaging	Het
Sart3	T	C	5: 113,771,352	N95S	probably benign	Het
Scpep1	A	G	11: 88,929,220	F414S	probably damaging	Het
Selenbp1	C	A	3: 94,937,348	Y105*	probably null	Het
Sirpa	A	G	2: 129,616,445	D327G	probably benign	Het
Sowahc	G	A	10: 59,222,183	R47H	probably damaging	Het
Szt2	T	C	4: 118,393,828	Y361C	probably damaging	Het
Taf3	A	G	2: 9,940,993	V600A	probably benign	Het
Tie1	T	C	4: 118,472,978	I1042M	probably damaging	Het
Tmem132e	T	A	11: 82,434,516	L114Q	probably damaging	Het
Tmx3	A	G	18: 90,537,109	T317A	probably damaging	Het
Tppp3	A	G	8: 105,468,292	V69A	probably benign	Het
Tpr	T	C	1: 150,423,516	Y1156H	probably damaging	Het
Trank1	A	C	9: 111,365,296	D796A	possibly damaging	Het
Tsc2	G	A	17: 24,607,492	P928S	probably benign	Het
Unc80	G	T	1: 66,672,684	V2722F	possibly damaging	Het
Vmn1r199	G	T	13: 22,382,675	L46F	probably benign	Het
Vps13a	A	T	19: 16,750,149	H196Q	probably benign	Het
Wnt10a	T	A	1: 74,793,474	C75*	probably null	Het
Zfp335	A	G	2: 164,892,539		probably null	Het

Other mutations in Notch2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00675:Notch2	APN	3	98111675	missense	possibly damaging	0.77
IGL01517:Notch2	APN	3	98138655	missense	probably benign	0.16
IGL01630:Notch2	APN	3	98146618	missense	possibly damaging	0.77
IGL01637:Notch2	APN	3	98146060	missense	probably damaging	1.00
IGL01828:Notch2	APN	3	98072613	missense	probably damaging	1.00
IGL01998:Notch2	APN	3	98143106	missense	probably damaging	1.00
IGL02008:Notch2	APN	3	98147296	missense	probably damaging	1.00
IGL02030:Notch2	APN	3	98099421	splice site	probably null
IGL02155:Notch2	APN	3	98138490	missense	probably damaging	0.98
IGL02268:Notch2	APN	3	98137397	missense	probably damaging	1.00
IGL02301:Notch2	APN	3	98141554	missense	probably benign	0.08
IGL02336:Notch2	APN	3	98138395	missense	possibly damaging	0.73
IGL02340:Notch2	APN	3	98147336	nonsense	probably null
IGL02536:Notch2	APN	3	98102407	missense	probably benign	0.03
IGL02589:Notch2	APN	3	98104347	critical splice acceptor site	probably null
IGL02633:Notch2	APN	3	98116697	splice site	probably benign
IGL02691:Notch2	APN	3	98135607	nonsense	probably null
IGL02832:Notch2	APN	3	98137373	missense	probably benign	0.12
IGL02894:Notch2	APN	3	98102432	nonsense	probably null
IGL02902:Notch2	APN	3	98111574	missense	probably damaging	1.00
IGL02967:Notch2	APN	3	98146144	missense	probably damaging	0.99
IGL03015:Notch2	APN	3	98072649	missense	possibly damaging	0.83
PIT4378001:Notch2	UTSW	3	98142956	missense	probably damaging	1.00
PIT4519001:Notch2	UTSW	3	98098108	missense	probably damaging	1.00
PIT4581001:Notch2	UTSW	3	98104462	missense	probably damaging	1.00
R0111:Notch2	UTSW	3	98138761	missense	probably benign	0.00
R0129:Notch2	UTSW	3	98146620	missense	probably benign	0.08
R0143:Notch2	UTSW	3	98146117	missense	probably damaging	0.99
R0480:Notch2	UTSW	3	98146537	missense	possibly damaging	0.88
R0523:Notch2	UTSW	3	98070970	missense	probably benign	0.34
R0523:Notch2	UTSW	3	98111598	missense	probably benign	0.00
R0531:Notch2	UTSW	3	98102451	splice site	probably benign
R0537:Notch2	UTSW	3	98116741	missense	possibly damaging	0.70
R0987:Notch2	UTSW	3	98134677	splice site	probably null
R1485:Notch2	UTSW	3	98100257	missense	probably benign	0.00
R1555:Notch2	UTSW	3	98131340	missense	possibly damaging	0.93
R1625:Notch2	UTSW	3	98111575	missense	probably damaging	1.00
R1699:Notch2	UTSW	3	98145127	missense	probably damaging	1.00
R1765:Notch2	UTSW	3	98121926	missense	probably damaging	1.00
R1794:Notch2	UTSW	3	98099547	missense	possibly damaging	0.53
R1974:Notch2	UTSW	3	98072755	missense	probably damaging	1.00
R2086:Notch2	UTSW	3	98102367	missense	probably damaging	1.00
R2099:Notch2	UTSW	3	98115321	missense	possibly damaging	0.79
R3778:Notch2	UTSW	3	98146623	missense	probably damaging	1.00
R3924:Notch2	UTSW	3	98122034	nonsense	probably null
R4018:Notch2	UTSW	3	98104565	missense	probably damaging	1.00
R4151:Notch2	UTSW	3	98147071	missense	possibly damaging	0.95
R4417:Notch2	UTSW	3	98131270	missense	possibly damaging	0.95
R4510:Notch2	UTSW	3	98146321	missense	probably benign	0.02
R4511:Notch2	UTSW	3	98146321	missense	probably benign	0.02
R4636:Notch2	UTSW	3	98146104	missense	probably benign	0.02
R4661:Notch2	UTSW	3	98135513	missense	probably damaging	1.00
R4856:Notch2	UTSW	3	98102419	missense	probably damaging	1.00
R4886:Notch2	UTSW	3	98102419	missense	probably damaging	1.00
R4945:Notch2	UTSW	3	98111721	missense	probably benign	0.01
R4970:Notch2	UTSW	3	98101636	critical splice donor site	probably null
R4974:Notch2	UTSW	3	98139633	missense	probably benign	0.39
R5082:Notch2	UTSW	3	98100374	missense	probably damaging	1.00
R5112:Notch2	UTSW	3	98101636	critical splice donor site	probably null
R5156:Notch2	UTSW	3	98124310	missense	possibly damaging	0.53
R5433:Notch2	UTSW	3	98126134	missense	probably damaging	1.00
R5539:Notch2	UTSW	3	98137582	missense	probably damaging	0.99
R5813:Notch2	UTSW	3	98135428	missense	probably benign
R5827:Notch2	UTSW	3	98072862	missense	possibly damaging	0.64
R5908:Notch2	UTSW	3	98123923	intron	probably benign
R6021:Notch2	UTSW	3	98121972	missense	probably damaging	1.00
R6090:Notch2	UTSW	3	98135377	nonsense	probably null
R6103:Notch2	UTSW	3	98135743	missense	possibly damaging	0.94
R6111:Notch2	UTSW	3	98146293	missense	probably benign	0.00
R6168:Notch2	UTSW	3	98145217	missense	probably damaging	1.00
R6382:Notch2	UTSW	3	98141543	missense	probably damaging	1.00
R6404:Notch2	UTSW	3	98081998	missense	probably damaging	1.00
R6419:Notch2	UTSW	3	98100389	critical splice donor site	probably null
R6454:Notch2	UTSW	3	98137406	missense	possibly damaging	0.47
R6626:Notch2	UTSW	3	98101605	missense	probably damaging	1.00
R6629:Notch2	UTSW	3	98120881	missense	possibly damaging	0.65
R6706:Notch2	UTSW	3	98138430	missense	possibly damaging	0.94
R6735:Notch2	UTSW	3	98134586	missense	probably damaging	1.00
R6837:Notch2	UTSW	3	98070854	splice site	probably null
R7021:Notch2	UTSW	3	98135446	missense	probably benign
R7028:Notch2	UTSW	3	98102387	missense	probably damaging	1.00
R7228:Notch2	UTSW	3	98137317	nonsense	probably null
R7320:Notch2	UTSW	3	98131327	missense	possibly damaging	0.94
R7361:Notch2	UTSW	3	98131402	missense	probably benign	0.04
R7562:Notch2	UTSW	3	98113114	missense	probably damaging	1.00
R7630:Notch2	UTSW	3	98137508	missense	possibly damaging	0.65
R7748:Notch2	UTSW	3	98138484	missense	possibly damaging	0.69
R7764:Notch2	UTSW	3	98142988	missense	probably damaging	1.00
R7817:Notch2	UTSW	3	98107127	missense	probably damaging	1.00
R7952:Notch2	UTSW	3	98100236	missense	probably benign	0.30
R8136:Notch2	UTSW	3	98124221	missense	probably damaging	1.00
R8159:Notch2	UTSW	3	98120922	missense	possibly damaging	0.95
R8679:Notch2	UTSW	3	98121902	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGTCTGAACGAGAAGGTCCAG -3'
(R):5'- ACATTTCACTGTACTGGGTCTC -3'

Sequencing Primer
(F):5'- AACGAGAAGGTCCAGCTGTCC -3'
(R):5'- ACTGTACTGGGTCTCGTTCATC -3'

Posted On

2019-10-24