Incidental Mutation 'R7637:Sart3'
ID590009
Institutional Source Beutler Lab
Gene Symbol Sart3
Ensembl Gene ENSMUSG00000018974
Gene Namesquamous cell carcinoma antigen recognized by T cells 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.972) question?
Stock #R7637 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location113742446-113772510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113771352 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 95 (N95S)
Ref Sequence ENSEMBL: ENSMUSP00000019118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019118] [ENSMUST00000026937] [ENSMUST00000112311] [ENSMUST00000112312] [ENSMUST00000123616] [ENSMUST00000145592] [ENSMUST00000145778] [ENSMUST00000197041]
Predicted Effect probably benign
Transcript: ENSMUST00000019118
AA Change: N95S

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000019118
Gene: ENSMUSG00000018974
AA Change: N95S

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 11 33 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
HAT 127 159 1.76e1 SMART
HAT 165 196 4.82e-1 SMART
HAT 202 238 1.53e-3 SMART
low complexity region 269 281 N/A INTRINSIC
HAT 325 357 1.78e-4 SMART
HAT 360 392 7.83e-1 SMART
HAT 395 431 7.56e0 SMART
HAT 488 521 7.31e-1 SMART
coiled coil region 554 619 N/A INTRINSIC
low complexity region 626 640 N/A INTRINSIC
RRM 705 778 1.87e-14 SMART
RRM 802 874 3.2e-22 SMART
Pfam:LSM_int_assoc 877 937 3.1e-28 PFAM
Pfam:Lsm_interact 944 961 2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026937
SMART Domains Protein: ENSMUSP00000026937
Gene: ENSMUSG00000025825

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:NifU_N 35 161 3.9e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112311
SMART Domains Protein: ENSMUSP00000107930
Gene: ENSMUSG00000025825

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:NifU_N 35 149 1.1e-51 PFAM
low complexity region 170 188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112312
SMART Domains Protein: ENSMUSP00000107931
Gene: ENSMUSG00000025825

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:NifU_N 35 149 3.4e-49 PFAM
low complexity region 170 188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123616
SMART Domains Protein: ENSMUSP00000117973
Gene: ENSMUSG00000025825

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134881
Predicted Effect probably benign
Transcript: ENSMUST00000145592
SMART Domains Protein: ENSMUSP00000123237
Gene: ENSMUSG00000025825

DomainStartEndE-ValueType
Pfam:NifU_N 32 136 2.7e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145778
Predicted Effect possibly damaging
Transcript: ENSMUST00000197041
AA Change: N95S

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143778
Gene: ENSMUSG00000018974
AA Change: N95S

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 11 33 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
HAT 127 159 1.76e1 SMART
HAT 165 196 4.82e-1 SMART
HAT 202 238 1.53e-3 SMART
low complexity region 269 281 N/A INTRINSIC
Blast:HAT 292 323 1e-5 BLAST
HAT 325 357 1.33e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA-binding nuclear protein that is a tumor-rejection antigen. This antigen possesses tumor epitopes capable of inducing HLA-A24-restricted and tumor-specific cytotoxic T lymphocytes in cancer patients and may be useful for specific immunotherapy. This gene product is found to be an important cellular factor for HIV-1 gene expression and viral replication. It also associates transiently with U6 and U4/U6 snRNPs during the recycling phase of the spliceosome cycle. This encoded protein is thought to be involved in the regulation of mRNA splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in hematopoietic cells exhibit protection against the effects of 5-FU treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,218,952 Q651L probably benign Het
Adam8 C T 7: 139,985,430 V624I probably damaging Het
Ccdc144b T A 3: 36,046,876 Q49L probably damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Cmya5 T C 13: 93,083,212 K3243R possibly damaging Het
Dock5 G A 14: 67,786,340 T1124M possibly damaging Het
Fam8a1 A T 13: 46,671,247 M237L probably benign Het
Fars2 G T 13: 36,204,775 K82N probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm5767 C T 16: 8,683,646 P59L unknown Het
Gnat3 A G 5: 18,003,772 D158G Het
Grhl2 A C 15: 37,328,330 N400T probably damaging Het
Grin2c A T 11: 115,256,259 probably null Het
Hipk4 A G 7: 27,523,548 Y11C probably damaging Het
Hspa9 G T 18: 34,938,687 A620E not run Het
Igkv12-89 A G 6: 68,835,099 S29P probably benign Het
Itga8 A T 2: 12,109,187 D1039E probably damaging Het
Itgae A T 11: 73,113,631 D248V probably damaging Het
Kmt2c T C 5: 25,315,095 K2006E probably damaging Het
Mdga1 C T 17: 29,832,379 G934R probably benign Het
Mov10 T C 3: 104,795,885 N896S probably benign Het
Ndufb6 A T 4: 40,273,080 probably null Het
Nlk T C 11: 78,591,005 probably null Het
Notch2 T A 3: 98,146,623 S2201T probably damaging Het
Olfr152 A T 2: 87,783,434 D298V probably damaging Het
Pank1 A C 19: 34,821,988 probably null Het
Pdlim3 T C 8: 45,909,065 F126S probably damaging Het
Pds5a C A 5: 65,638,604 G648C probably benign Het
Plekhh3 T C 11: 101,164,327 I567V unknown Het
Ppfia2 T C 10: 106,865,403 probably null Het
Prl3d1 A G 13: 27,100,069 D207G probably damaging Het
Prss23 T A 7: 89,510,246 D205V probably benign Het
Pygl C T 12: 70,197,795 probably null Het
Qsox2 A G 2: 26,221,020 F111S probably damaging Het
Scpep1 A G 11: 88,929,220 F414S probably damaging Het
Selenbp1 C A 3: 94,937,348 Y105* probably null Het
Sirpa A G 2: 129,616,445 D327G probably benign Het
Sowahc G A 10: 59,222,183 R47H probably damaging Het
Szt2 T C 4: 118,393,828 Y361C probably damaging Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tie1 T C 4: 118,472,978 I1042M probably damaging Het
Tmem132e T A 11: 82,434,516 L114Q probably damaging Het
Tmx3 A G 18: 90,537,109 T317A probably damaging Het
Tppp3 A G 8: 105,468,292 V69A probably benign Het
Tpr T C 1: 150,423,516 Y1156H probably damaging Het
Trank1 A C 9: 111,365,296 D796A possibly damaging Het
Tsc2 G A 17: 24,607,492 P928S probably benign Het
Unc80 G T 1: 66,672,684 V2722F possibly damaging Het
Vmn1r199 G T 13: 22,382,675 L46F probably benign Het
Vps13a A T 19: 16,750,149 H196Q probably benign Het
Wnt10a T A 1: 74,793,474 C75* probably null Het
Zfp335 A G 2: 164,892,539 probably null Het
Other mutations in Sart3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sart3 APN 5 113746669 missense probably benign
IGL01309:Sart3 APN 5 113759250 missense probably damaging 1.00
IGL01844:Sart3 APN 5 113745648 nonsense probably null
IGL02147:Sart3 APN 5 113762943 splice site probably benign
R0048:Sart3 UTSW 5 113755397 missense possibly damaging 0.92
R0048:Sart3 UTSW 5 113755397 missense possibly damaging 0.92
R0268:Sart3 UTSW 5 113752399 missense probably damaging 0.99
R1703:Sart3 UTSW 5 113752219 missense probably benign 0.22
R1704:Sart3 UTSW 5 113746007 missense probably benign 0.14
R1998:Sart3 UTSW 5 113747921 critical splice donor site probably null
R2142:Sart3 UTSW 5 113764093 missense probably damaging 0.97
R3893:Sart3 UTSW 5 113746636 missense probably benign 0.00
R3895:Sart3 UTSW 5 113752427 nonsense probably null
R4231:Sart3 UTSW 5 113771418 missense probably benign
R5367:Sart3 UTSW 5 113759216 splice site probably null
R5488:Sart3 UTSW 5 113771380 missense probably damaging 1.00
R5489:Sart3 UTSW 5 113771380 missense probably damaging 1.00
R5668:Sart3 UTSW 5 113745156 splice site probably null
R5903:Sart3 UTSW 5 113751239 missense probably damaging 0.98
R6046:Sart3 UTSW 5 113755446 missense probably damaging 1.00
R6173:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6215:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6216:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6221:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6222:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6320:Sart3 UTSW 5 113751240 missense probably benign 0.34
R6824:Sart3 UTSW 5 113744539 splice site probably null
R6978:Sart3 UTSW 5 113745746 missense probably damaging 0.97
R7062:Sart3 UTSW 5 113745602 missense possibly damaging 0.49
R7162:Sart3 UTSW 5 113762835 missense probably damaging 1.00
R7165:Sart3 UTSW 5 113745995 missense probably benign 0.01
R7222:Sart3 UTSW 5 113746656 missense probably benign 0.01
R7235:Sart3 UTSW 5 113753642 missense probably damaging 1.00
R7237:Sart3 UTSW 5 113754246 missense possibly damaging 0.70
R7340:Sart3 UTSW 5 113744667 missense probably benign 0.02
R7580:Sart3 UTSW 5 113754379 splice site probably null
R8146:Sart3 UTSW 5 113747957 missense probably damaging 0.98
R8241:Sart3 UTSW 5 113745968 missense probably benign 0.32
X0058:Sart3 UTSW 5 113745928 missense probably benign
Z1176:Sart3 UTSW 5 113745824 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGGAATACTTTAGGGACGCCC -3'
(R):5'- AGTTTTGATCAGGCAGACGC -3'

Sequencing Primer
(F):5'- CGCACTGAGCCGGGGAC -3'
(R):5'- ACGACGGCCGCATCTTC -3'
Posted On2019-10-24