Incidental Mutation 'R7637:Hipk4'
ID590011
Institutional Source Beutler Lab
Gene Symbol Hipk4
Ensembl Gene ENSMUSG00000040424
Gene Namehomeodomain interacting protein kinase 4
SynonymsLOC233020
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7637 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location27523267-27531175 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27523548 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 11 (Y11C)
Ref Sequence ENSEMBL: ENSMUSP00000103990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037134] [ENSMUST00000065487] [ENSMUST00000098644] [ENSMUST00000108353] [ENSMUST00000108355] [ENSMUST00000125990]
Predicted Effect probably benign
Transcript: ENSMUST00000037134
SMART Domains Protein: ENSMUSP00000043175
Gene: ENSMUSG00000040424

DomainStartEndE-ValueType
SCOP:d1howa_ 1 142 8e-12 SMART
Blast:S_TKc 1 143 8e-99 BLAST
PDB:3ANR|D 1 155 1e-12 PDB
low complexity region 192 206 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065487
SMART Domains Protein: ENSMUSP00000066110
Gene: ENSMUSG00000053198

DomainStartEndE-ValueType
PDZ 28 100 6.83e-8 SMART
low complexity region 179 232 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
internal_repeat_3 316 419 9.05e-5 PROSPERO
internal_repeat_2 317 428 7.28e-6 PROSPERO
internal_repeat_1 321 508 8.09e-9 PROSPERO
internal_repeat_1 503 779 8.09e-9 PROSPERO
internal_repeat_2 840 974 7.28e-6 PROSPERO
internal_repeat_3 1176 1268 9.05e-5 PROSPERO
low complexity region 1275 1314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098644
SMART Domains Protein: ENSMUSP00000096241
Gene: ENSMUSG00000053198

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDZ 28 100 6.83e-8 SMART
low complexity region 179 232 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
internal_repeat_3 316 419 5.13e-5 PROSPERO
internal_repeat_2 317 428 3.79e-6 PROSPERO
internal_repeat_1 321 508 3.34e-9 PROSPERO
internal_repeat_1 503 779 3.34e-9 PROSPERO
internal_repeat_2 840 974 3.79e-6 PROSPERO
internal_repeat_3 1176 1268 5.13e-5 PROSPERO
low complexity region 1275 1314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108353
AA Change: Y11C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103990
Gene: ENSMUSG00000040424
AA Change: Y11C

DomainStartEndE-ValueType
S_TKc 11 347 9.31e-74 SMART
low complexity region 396 410 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108355
SMART Domains Protein: ENSMUSP00000103992
Gene: ENSMUSG00000053198

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDZ 28 100 6.83e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125990
Meta Mutation Damage Score 0.8365 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the homeodomain interacting protein kinase (HIPK) family of proteins. While other members of this family are found throughout vertebrates, this member is present only in mammals. Compared to other members of this family, the encoded protein lacks a nuclear localization signal and a C-terminal autoinhibitory domain. The encoded protein exhibits kinase activity and may phosphorylate the tumor suppressor protein p53. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,218,952 Q651L probably benign Het
Adam8 C T 7: 139,985,430 V624I probably damaging Het
Ccdc144b T A 3: 36,046,876 Q49L probably damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Cmya5 T C 13: 93,083,212 K3243R possibly damaging Het
Dock5 G A 14: 67,786,340 T1124M possibly damaging Het
Fam8a1 A T 13: 46,671,247 M237L probably benign Het
Fars2 G T 13: 36,204,775 K82N probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm5767 C T 16: 8,683,646 P59L unknown Het
Gnat3 A G 5: 18,003,772 D158G Het
Grhl2 A C 15: 37,328,330 N400T probably damaging Het
Grin2c A T 11: 115,256,259 probably null Het
Hspa9 G T 18: 34,938,687 A620E not run Het
Igkv12-89 A G 6: 68,835,099 S29P probably benign Het
Itga8 A T 2: 12,109,187 D1039E probably damaging Het
Itgae A T 11: 73,113,631 D248V probably damaging Het
Kmt2c T C 5: 25,315,095 K2006E probably damaging Het
Mdga1 C T 17: 29,832,379 G934R probably benign Het
Mov10 T C 3: 104,795,885 N896S probably benign Het
Ndufb6 A T 4: 40,273,080 probably null Het
Nlk T C 11: 78,591,005 probably null Het
Notch2 T A 3: 98,146,623 S2201T probably damaging Het
Olfr152 A T 2: 87,783,434 D298V probably damaging Het
Pank1 A C 19: 34,821,988 probably null Het
Pdlim3 T C 8: 45,909,065 F126S probably damaging Het
Pds5a C A 5: 65,638,604 G648C probably benign Het
Plekhh3 T C 11: 101,164,327 I567V unknown Het
Ppfia2 T C 10: 106,865,403 probably null Het
Prl3d1 A G 13: 27,100,069 D207G probably damaging Het
Prss23 T A 7: 89,510,246 D205V probably benign Het
Pygl C T 12: 70,197,795 probably null Het
Qsox2 A G 2: 26,221,020 F111S probably damaging Het
Sart3 T C 5: 113,771,352 N95S probably benign Het
Scpep1 A G 11: 88,929,220 F414S probably damaging Het
Selenbp1 C A 3: 94,937,348 Y105* probably null Het
Sirpa A G 2: 129,616,445 D327G probably benign Het
Sowahc G A 10: 59,222,183 R47H probably damaging Het
Szt2 T C 4: 118,393,828 Y361C probably damaging Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tie1 T C 4: 118,472,978 I1042M probably damaging Het
Tmem132e T A 11: 82,434,516 L114Q probably damaging Het
Tmx3 A G 18: 90,537,109 T317A probably damaging Het
Tppp3 A G 8: 105,468,292 V69A probably benign Het
Tpr T C 1: 150,423,516 Y1156H probably damaging Het
Trank1 A C 9: 111,365,296 D796A possibly damaging Het
Tsc2 G A 17: 24,607,492 P928S probably benign Het
Unc80 G T 1: 66,672,684 V2722F possibly damaging Het
Vmn1r199 G T 13: 22,382,675 L46F probably benign Het
Vps13a A T 19: 16,750,149 H196Q probably benign Het
Wnt10a T A 1: 74,793,474 C75* probably null Het
Zfp335 A G 2: 164,892,539 probably null Het
Other mutations in Hipk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01756:Hipk4 APN 7 27528543 nonsense probably null
IGL02712:Hipk4 APN 7 27528635 missense probably damaging 1.00
R2018:Hipk4 UTSW 7 27529004 missense probably damaging 1.00
R3813:Hipk4 UTSW 7 27523947 missense probably damaging 1.00
R4796:Hipk4 UTSW 7 27528570 missense probably benign 0.00
R5121:Hipk4 UTSW 7 27529492 missense probably benign 0.02
R5738:Hipk4 UTSW 7 27528416 missense probably damaging 1.00
R5776:Hipk4 UTSW 7 27528980 missense probably damaging 1.00
R6142:Hipk4 UTSW 7 27529165 missense probably damaging 1.00
R6578:Hipk4 UTSW 7 27528387 missense probably damaging 1.00
R8160:Hipk4 UTSW 7 27523761 missense possibly damaging 0.77
R8343:Hipk4 UTSW 7 27523608 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGGGGCTGAACTCATATAAGG -3'
(R):5'- TAGAACTTGAGGGCATCGTGG -3'

Sequencing Primer
(F):5'- GCTGAACTCATATAAGGAGAGACAC -3'
(R):5'- ATAACGTGGGCCTCGTCAG -3'
Posted On2019-10-24