Incidental Mutation 'R7637:Sowahc'
ID590018
Institutional Source Beutler Lab
Gene Symbol Sowahc
Ensembl Gene ENSMUSG00000098188
Gene Namesosondowah ankyrin repeat domain family member C
SynonymsC820004L04Rik, Ankrd57
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R7637 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location59221953-59226434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59222183 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 47 (R47H)
Ref Sequence ENSEMBL: ENSMUSP00000138351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165971] [ENSMUST00000182161] [ENSMUST00000220156]
Predicted Effect probably benign
Transcript: ENSMUST00000165971
SMART Domains Protein: ENSMUSP00000129023
Gene: ENSMUSG00000019917

DomainStartEndE-ValueType
Pfam:Septin 36 307 1.1e-100 PFAM
Pfam:MMR_HSR1 41 182 2.2e-7 PFAM
low complexity region 374 389 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182161
AA Change: R47H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138351
Gene: ENSMUSG00000098188
AA Change: R47H

DomainStartEndE-ValueType
low complexity region 173 187 N/A INTRINSIC
low complexity region 213 250 N/A INTRINSIC
ANK 288 323 1.54e-1 SMART
ANK 327 357 3.57e-6 SMART
low complexity region 434 452 N/A INTRINSIC
low complexity region 481 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220156
Meta Mutation Damage Score 0.3404 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,218,952 Q651L probably benign Het
Adam8 C T 7: 139,985,430 V624I probably damaging Het
Ccdc144b T A 3: 36,046,876 Q49L probably damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Cmya5 T C 13: 93,083,212 K3243R possibly damaging Het
Dock5 G A 14: 67,786,340 T1124M possibly damaging Het
Fam8a1 A T 13: 46,671,247 M237L probably benign Het
Fars2 G T 13: 36,204,775 K82N probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm5767 C T 16: 8,683,646 P59L unknown Het
Gnat3 A G 5: 18,003,772 D158G Het
Grhl2 A C 15: 37,328,330 N400T probably damaging Het
Grin2c A T 11: 115,256,259 probably null Het
Hipk4 A G 7: 27,523,548 Y11C probably damaging Het
Hspa9 G T 18: 34,938,687 A620E not run Het
Igkv12-89 A G 6: 68,835,099 S29P probably benign Het
Itga8 A T 2: 12,109,187 D1039E probably damaging Het
Itgae A T 11: 73,113,631 D248V probably damaging Het
Kmt2c T C 5: 25,315,095 K2006E probably damaging Het
Mdga1 C T 17: 29,832,379 G934R probably benign Het
Mov10 T C 3: 104,795,885 N896S probably benign Het
Ndufb6 A T 4: 40,273,080 probably null Het
Nlk T C 11: 78,591,005 probably null Het
Notch2 T A 3: 98,146,623 S2201T probably damaging Het
Olfr152 A T 2: 87,783,434 D298V probably damaging Het
Pank1 A C 19: 34,821,988 probably null Het
Pdlim3 T C 8: 45,909,065 F126S probably damaging Het
Pds5a C A 5: 65,638,604 G648C probably benign Het
Plekhh3 T C 11: 101,164,327 I567V unknown Het
Ppfia2 T C 10: 106,865,403 probably null Het
Prl3d1 A G 13: 27,100,069 D207G probably damaging Het
Prss23 T A 7: 89,510,246 D205V probably benign Het
Pygl C T 12: 70,197,795 probably null Het
Qsox2 A G 2: 26,221,020 F111S probably damaging Het
Sart3 T C 5: 113,771,352 N95S probably benign Het
Scpep1 A G 11: 88,929,220 F414S probably damaging Het
Selenbp1 C A 3: 94,937,348 Y105* probably null Het
Sirpa A G 2: 129,616,445 D327G probably benign Het
Szt2 T C 4: 118,393,828 Y361C probably damaging Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tie1 T C 4: 118,472,978 I1042M probably damaging Het
Tmem132e T A 11: 82,434,516 L114Q probably damaging Het
Tmx3 A G 18: 90,537,109 T317A probably damaging Het
Tppp3 A G 8: 105,468,292 V69A probably benign Het
Tpr T C 1: 150,423,516 Y1156H probably damaging Het
Trank1 A C 9: 111,365,296 D796A possibly damaging Het
Tsc2 G A 17: 24,607,492 P928S probably benign Het
Unc80 G T 1: 66,672,684 V2722F possibly damaging Het
Vmn1r199 G T 13: 22,382,675 L46F probably benign Het
Vps13a A T 19: 16,750,149 H196Q probably benign Het
Wnt10a T A 1: 74,793,474 C75* probably null Het
Zfp335 A G 2: 164,892,539 probably null Het
Other mutations in Sowahc
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0744:Sowahc UTSW 10 59223491 unclassified probably benign
R0753:Sowahc UTSW 10 59223491 unclassified probably benign
R4747:Sowahc UTSW 10 59223161 missense probably benign 0.07
R5523:Sowahc UTSW 10 59222963 missense probably benign 0.01
R5650:Sowahc UTSW 10 59223491 unclassified probably benign
R5658:Sowahc UTSW 10 59223227 missense possibly damaging 0.46
R5838:Sowahc UTSW 10 59223190 missense possibly damaging 0.88
R5959:Sowahc UTSW 10 59223098 missense probably benign 0.23
R6166:Sowahc UTSW 10 59222360 missense probably benign 0.44
R6365:Sowahc UTSW 10 59223527 missense probably damaging 1.00
R7203:Sowahc UTSW 10 59222278 missense probably benign
R7568:Sowahc UTSW 10 59223299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTCAAAGCTGGGATCGC -3'
(R):5'- ACTGTGGATTTGCCTCCTGG -3'

Sequencing Primer
(F):5'- CCATGGTGTCTGGCTGAGC -3'
(R):5'- ATTTGCCTCCTGGAGCTGGC -3'
Posted On2019-10-24