Incidental Mutation 'R7637:Ppfia2'
ID590019
Institutional Source Beutler Lab
Gene Symbol Ppfia2
Ensembl Gene ENSMUSG00000053825
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
SynonymsLiprin-alpha2, E130120L08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7637 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location106470339-106935952 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 106865403 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029404] [ENSMUST00000217854]
Predicted Effect probably null
Transcript: ENSMUST00000029404
SMART Domains Protein: ENSMUSP00000029404
Gene: ENSMUSG00000053825

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
coiled coil region 32 80 N/A INTRINSIC
coiled coil region 102 150 N/A INTRINSIC
coiled coil region 189 234 N/A INTRINSIC
coiled coil region 267 541 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
coiled coil region 643 691 N/A INTRINSIC
low complexity region 702 725 N/A INTRINSIC
SAM 895 964 6.27e-10 SMART
low complexity region 965 977 N/A INTRINSIC
SAM 1017 1084 1.69e-6 SMART
SAM 1105 1177 6.62e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000217854
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. It has been proposed that liprins are multivalent proteins that form complex structures and act as scaffolds for the recruitment and anchoring of LAR family of tyrosine phosphatases. This protein has been shown to bind the calcium/calmodulin-dependent serine protein kinase (MAGUK family) protein (also known as CASK) and proposed to regulate higher-order brain functions in mammals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,218,952 Q651L probably benign Het
Adam8 C T 7: 139,985,430 V624I probably damaging Het
Ccdc144b T A 3: 36,046,876 Q49L probably damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Cmya5 T C 13: 93,083,212 K3243R possibly damaging Het
Dock5 G A 14: 67,786,340 T1124M possibly damaging Het
Fam8a1 A T 13: 46,671,247 M237L probably benign Het
Fars2 G T 13: 36,204,775 K82N probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm5767 C T 16: 8,683,646 P59L unknown Het
Gnat3 A G 5: 18,003,772 D158G Het
Grhl2 A C 15: 37,328,330 N400T probably damaging Het
Grin2c A T 11: 115,256,259 probably null Het
Hipk4 A G 7: 27,523,548 Y11C probably damaging Het
Hspa9 G T 18: 34,938,687 A620E not run Het
Igkv12-89 A G 6: 68,835,099 S29P probably benign Het
Itga8 A T 2: 12,109,187 D1039E probably damaging Het
Itgae A T 11: 73,113,631 D248V probably damaging Het
Kmt2c T C 5: 25,315,095 K2006E probably damaging Het
Mdga1 C T 17: 29,832,379 G934R probably benign Het
Mov10 T C 3: 104,795,885 N896S probably benign Het
Ndufb6 A T 4: 40,273,080 probably null Het
Nlk T C 11: 78,591,005 probably null Het
Notch2 T A 3: 98,146,623 S2201T probably damaging Het
Olfr152 A T 2: 87,783,434 D298V probably damaging Het
Pank1 A C 19: 34,821,988 probably null Het
Pdlim3 T C 8: 45,909,065 F126S probably damaging Het
Pds5a C A 5: 65,638,604 G648C probably benign Het
Plekhh3 T C 11: 101,164,327 I567V unknown Het
Prl3d1 A G 13: 27,100,069 D207G probably damaging Het
Prss23 T A 7: 89,510,246 D205V probably benign Het
Pygl C T 12: 70,197,795 probably null Het
Qsox2 A G 2: 26,221,020 F111S probably damaging Het
Sart3 T C 5: 113,771,352 N95S probably benign Het
Scpep1 A G 11: 88,929,220 F414S probably damaging Het
Selenbp1 C A 3: 94,937,348 Y105* probably null Het
Sirpa A G 2: 129,616,445 D327G probably benign Het
Sowahc G A 10: 59,222,183 R47H probably damaging Het
Szt2 T C 4: 118,393,828 Y361C probably damaging Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tie1 T C 4: 118,472,978 I1042M probably damaging Het
Tmem132e T A 11: 82,434,516 L114Q probably damaging Het
Tmx3 A G 18: 90,537,109 T317A probably damaging Het
Tppp3 A G 8: 105,468,292 V69A probably benign Het
Tpr T C 1: 150,423,516 Y1156H probably damaging Het
Trank1 A C 9: 111,365,296 D796A possibly damaging Het
Tsc2 G A 17: 24,607,492 P928S probably benign Het
Unc80 G T 1: 66,672,684 V2722F possibly damaging Het
Vmn1r199 G T 13: 22,382,675 L46F probably benign Het
Vps13a A T 19: 16,750,149 H196Q probably benign Het
Wnt10a T A 1: 74,793,474 C75* probably null Het
Zfp335 A G 2: 164,892,539 probably null Het
Other mutations in Ppfia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Ppfia2 APN 10 106819492 missense probably benign 0.25
IGL01296:Ppfia2 APN 10 106858207 missense probably damaging 0.98
IGL01385:Ppfia2 APN 10 106913699 missense probably damaging 1.00
IGL01592:Ppfia2 APN 10 106836048 splice site probably benign
IGL01899:Ppfia2 APN 10 106915751 critical splice donor site probably null
IGL02063:Ppfia2 APN 10 106904845 missense probably null 0.83
IGL02143:Ppfia2 APN 10 106857499 missense probably damaging 1.00
IGL02170:Ppfia2 APN 10 106800785 missense probably benign
IGL02565:Ppfia2 APN 10 106863386 critical splice donor site probably null
IGL02573:Ppfia2 APN 10 106828928 missense probably damaging 1.00
IGL02819:Ppfia2 APN 10 106906394 missense probably damaging 1.00
IGL02974:Ppfia2 APN 10 106800776 missense probably benign 0.08
IGL03165:Ppfia2 APN 10 106767487 missense probably damaging 1.00
IGL03255:Ppfia2 APN 10 106896507 missense possibly damaging 0.76
Colorless UTSW 10 106913594 missense probably damaging 1.00
PIT4458001:Ppfia2 UTSW 10 106927847 missense probably benign 0.24
R0018:Ppfia2 UTSW 10 106842786 splice site probably benign
R0018:Ppfia2 UTSW 10 106842786 splice site probably benign
R0323:Ppfia2 UTSW 10 106896420 missense possibly damaging 0.84
R0391:Ppfia2 UTSW 10 106830714 splice site probably benign
R0667:Ppfia2 UTSW 10 106913694 missense probably damaging 0.97
R0782:Ppfia2 UTSW 10 106927731 missense probably benign 0.32
R0905:Ppfia2 UTSW 10 106819511 missense probably benign 0.43
R1401:Ppfia2 UTSW 10 106830657 missense possibly damaging 0.94
R1672:Ppfia2 UTSW 10 106830568 missense possibly damaging 0.53
R1723:Ppfia2 UTSW 10 106915672 splice site probably null
R1780:Ppfia2 UTSW 10 106896507 missense possibly damaging 0.76
R1847:Ppfia2 UTSW 10 106927710 missense probably benign 0.16
R2015:Ppfia2 UTSW 10 106474677 missense probably benign 0.01
R2051:Ppfia2 UTSW 10 106837299 missense probably damaging 0.98
R2061:Ppfia2 UTSW 10 106837329 missense possibly damaging 0.94
R2115:Ppfia2 UTSW 10 106762111 missense probably damaging 1.00
R2310:Ppfia2 UTSW 10 106854980 missense probably damaging 0.99
R2394:Ppfia2 UTSW 10 106819490 missense probably damaging 0.99
R2656:Ppfia2 UTSW 10 106865407 splice site probably null
R3113:Ppfia2 UTSW 10 106906395 nonsense probably null
R3968:Ppfia2 UTSW 10 106906521 missense probably damaging 0.99
R3977:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R3978:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R3979:Ppfia2 UTSW 10 106830629 missense possibly damaging 0.69
R4567:Ppfia2 UTSW 10 106865406 splice site probably null
R4632:Ppfia2 UTSW 10 106836044 splice site probably null
R4718:Ppfia2 UTSW 10 106858285 missense probably damaging 1.00
R4758:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4770:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4810:Ppfia2 UTSW 10 106915690 missense probably benign 0.01
R4841:Ppfia2 UTSW 10 106854957 missense probably benign 0.04
R4842:Ppfia2 UTSW 10 106854957 missense probably benign 0.04
R4914:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4916:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R4917:Ppfia2 UTSW 10 106762117 missense probably damaging 1.00
R5014:Ppfia2 UTSW 10 106865363 nonsense probably null
R5029:Ppfia2 UTSW 10 106857443 missense probably benign 0.04
R5127:Ppfia2 UTSW 10 106835760 missense probably damaging 0.99
R5357:Ppfia2 UTSW 10 106904847 critical splice donor site probably null
R5420:Ppfia2 UTSW 10 106835701 missense possibly damaging 0.88
R6030:Ppfia2 UTSW 10 106906477 missense probably damaging 1.00
R6030:Ppfia2 UTSW 10 106906477 missense probably damaging 1.00
R6135:Ppfia2 UTSW 10 106857569 missense probably damaging 1.00
R6237:Ppfia2 UTSW 10 106913594 missense probably damaging 1.00
R6433:Ppfia2 UTSW 10 106913698 missense possibly damaging 0.94
R6457:Ppfia2 UTSW 10 106893500 missense probably damaging 1.00
R6542:Ppfia2 UTSW 10 106835725 missense probably damaging 0.99
R6674:Ppfia2 UTSW 10 106927772 missense probably benign 0.23
R6746:Ppfia2 UTSW 10 106906458 nonsense probably null
R6992:Ppfia2 UTSW 10 106474854 missense possibly damaging 0.88
R7060:Ppfia2 UTSW 10 106762109 missense probably damaging 1.00
R7346:Ppfia2 UTSW 10 106857495 missense possibly damaging 0.79
R7453:Ppfia2 UTSW 10 106927830 missense possibly damaging 0.82
R7555:Ppfia2 UTSW 10 106927826 missense probably benign 0.00
R7622:Ppfia2 UTSW 10 106830659 missense possibly damaging 0.86
R7866:Ppfia2 UTSW 10 106819529 missense probably damaging 0.97
R7897:Ppfia2 UTSW 10 106819538 missense probably damaging 0.99
R7937:Ppfia2 UTSW 10 106863372 missense probably benign 0.30
R7938:Ppfia2 UTSW 10 106474787 missense probably damaging 0.97
R8218:Ppfia2 UTSW 10 106863375 missense probably benign 0.07
R8431:Ppfia2 UTSW 10 106836091 nonsense probably null
X0021:Ppfia2 UTSW 10 106474677 missense probably benign 0.06
X0022:Ppfia2 UTSW 10 106893434 missense probably damaging 1.00
Z1176:Ppfia2 UTSW 10 106474645 missense probably damaging 0.97
Z1177:Ppfia2 UTSW 10 106906555 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATCGAAATGAACAGTCTTTCCTC -3'
(R):5'- TTCACAGTGTTAGTGCGATTTC -3'

Sequencing Primer
(F):5'- CGAAATGAACAGTCTTTCCTCTTTTG -3'
(R):5'- TAAATAAGCATTAATACACCCTGGC -3'
Posted On2019-10-24