Incidental Mutation 'R7637:Fars2'
ID590028
Institutional Source Beutler Lab
Gene Symbol Fars2
Ensembl Gene ENSMUSG00000021420
Gene Namephenylalanine-tRNA synthetase 2 (mitochondrial)
Synonyms2810431B21Rik, Fars1, 6720478K01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7637 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location36117412-36726280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 36204775 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 82 (K82N)
Ref Sequence ENSEMBL: ENSMUSP00000021857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021857] [ENSMUST00000099582] [ENSMUST00000223796] [ENSMUST00000224241] [ENSMUST00000224611] [ENSMUST00000224916]
Predicted Effect probably benign
Transcript: ENSMUST00000021857
AA Change: K82N

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021857
Gene: ENSMUSG00000021420
AA Change: K82N

DomainStartEndE-ValueType
Pfam:tRNA-synt_2d 69 208 3.3e-18 PFAM
Pfam:tRNA-synt_2d 223 343 9.5e-31 PFAM
FDX-ACB 358 450 1.5e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099582
SMART Domains Protein: ENSMUSP00000097177
Gene: ENSMUSG00000021420

DomainStartEndE-ValueType
Pfam:tRNA-synt_2d 4 111 2.6e-33 PFAM
FDX-ACB 126 218 1.5e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223796
AA Change: K82N

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000224241
AA Change: K82N

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000224611
AA Change: K82N

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224916
AA Change: K82N

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that transfers phenylalanine to its cognate tRNA. This protein localizes to the mitochondrion and plays a role in mitochondrial protein translation. Mutations in this gene can cause combined oxidative phosphorylation deficiency 14 (Alpers encephalopathy). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,218,952 Q651L probably benign Het
Adam8 C T 7: 139,985,430 V624I probably damaging Het
Ccdc144b T A 3: 36,046,876 Q49L probably damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Cmya5 T C 13: 93,083,212 K3243R possibly damaging Het
Dock5 G A 14: 67,786,340 T1124M possibly damaging Het
Fam8a1 A T 13: 46,671,247 M237L probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm5767 C T 16: 8,683,646 P59L unknown Het
Gnat3 A G 5: 18,003,772 D158G Het
Grhl2 A C 15: 37,328,330 N400T probably damaging Het
Grin2c A T 11: 115,256,259 probably null Het
Hipk4 A G 7: 27,523,548 Y11C probably damaging Het
Hspa9 G T 18: 34,938,687 A620E not run Het
Igkv12-89 A G 6: 68,835,099 S29P probably benign Het
Itga8 A T 2: 12,109,187 D1039E probably damaging Het
Itgae A T 11: 73,113,631 D248V probably damaging Het
Kmt2c T C 5: 25,315,095 K2006E probably damaging Het
Mdga1 C T 17: 29,832,379 G934R probably benign Het
Mov10 T C 3: 104,795,885 N896S probably benign Het
Ndufb6 A T 4: 40,273,080 probably null Het
Nlk T C 11: 78,591,005 probably null Het
Notch2 T A 3: 98,146,623 S2201T probably damaging Het
Olfr152 A T 2: 87,783,434 D298V probably damaging Het
Pank1 A C 19: 34,821,988 probably null Het
Pdlim3 T C 8: 45,909,065 F126S probably damaging Het
Pds5a C A 5: 65,638,604 G648C probably benign Het
Plekhh3 T C 11: 101,164,327 I567V unknown Het
Ppfia2 T C 10: 106,865,403 probably null Het
Prl3d1 A G 13: 27,100,069 D207G probably damaging Het
Prss23 T A 7: 89,510,246 D205V probably benign Het
Pygl C T 12: 70,197,795 probably null Het
Qsox2 A G 2: 26,221,020 F111S probably damaging Het
Sart3 T C 5: 113,771,352 N95S probably benign Het
Scpep1 A G 11: 88,929,220 F414S probably damaging Het
Selenbp1 C A 3: 94,937,348 Y105* probably null Het
Sirpa A G 2: 129,616,445 D327G probably benign Het
Sowahc G A 10: 59,222,183 R47H probably damaging Het
Szt2 T C 4: 118,393,828 Y361C probably damaging Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tie1 T C 4: 118,472,978 I1042M probably damaging Het
Tmem132e T A 11: 82,434,516 L114Q probably damaging Het
Tmx3 A G 18: 90,537,109 T317A probably damaging Het
Tppp3 A G 8: 105,468,292 V69A probably benign Het
Tpr T C 1: 150,423,516 Y1156H probably damaging Het
Trank1 A C 9: 111,365,296 D796A possibly damaging Het
Tsc2 G A 17: 24,607,492 P928S probably benign Het
Unc80 G T 1: 66,672,684 V2722F possibly damaging Het
Vmn1r199 G T 13: 22,382,675 L46F probably benign Het
Vps13a A T 19: 16,750,149 H196Q probably benign Het
Wnt10a T A 1: 74,793,474 C75* probably null Het
Zfp335 A G 2: 164,892,539 probably null Het
Other mutations in Fars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01876:Fars2 APN 13 36537311 missense probably benign 0.07
IGL02348:Fars2 APN 13 36537380 missense probably benign 0.00
IGL02406:Fars2 APN 13 36410162 missense probably benign 0.39
IGL02523:Fars2 APN 13 36204693 missense probably damaging 1.00
IGL02896:Fars2 APN 13 36204842 missense probably benign 0.02
IGL03299:Fars2 APN 13 36537410 nonsense probably null
IGL03308:Fars2 APN 13 36204687 missense possibly damaging 0.95
R0419:Fars2 UTSW 13 36537311 missense probably benign 0.07
R0546:Fars2 UTSW 13 36204586 missense probably benign 0.01
R1918:Fars2 UTSW 13 36204546 missense probably damaging 1.00
R3120:Fars2 UTSW 13 36246417 missense probably damaging 1.00
R3844:Fars2 UTSW 13 36205101 missense probably damaging 1.00
R4716:Fars2 UTSW 13 36205068 missense probably damaging 1.00
R4795:Fars2 UTSW 13 36537426 missense probably damaging 0.97
R4796:Fars2 UTSW 13 36537426 missense probably damaging 0.97
R4979:Fars2 UTSW 13 36204581 missense possibly damaging 0.54
R5262:Fars2 UTSW 13 36342018 missense probably damaging 1.00
R5413:Fars2 UTSW 13 36204562 nonsense probably null
R5475:Fars2 UTSW 13 36204570 missense probably benign
R5635:Fars2 UTSW 13 36410146 missense probably damaging 0.99
R6437:Fars2 UTSW 13 36204863 missense possibly damaging 0.80
R7676:Fars2 UTSW 13 36205043 missense probably benign 0.07
R8013:Fars2 UTSW 13 36205085 nonsense probably null
R8014:Fars2 UTSW 13 36205085 nonsense probably null
R8063:Fars2 UTSW 13 36204897 nonsense probably null
X0020:Fars2 UTSW 13 36204795 missense probably damaging 1.00
Z1177:Fars2 UTSW 13 36204731 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGATGCCATCAACATCG -3'
(R):5'- CACTGATGCGCTGATGTGTG -3'

Sequencing Primer
(F):5'- ATGCCATCAACATCGGGCTTG -3'
(R):5'- GCATGTGTGCCCGATTCAAGTAATAG -3'
Posted On2019-10-24