Incidental Mutation 'R7637:Grhl2'
ID590032
Institutional Source Beutler Lab
Gene Symbol Grhl2
Ensembl Gene ENSMUSG00000022286
Gene Namegrainyhead like transcription factor 2
SynonymsBOM, Tcfcp2l3, grainyheadlike, 0610015A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7637 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location37233036-37363569 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 37328330 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 400 (N400T)
Ref Sequence ENSEMBL: ENSMUSP00000022895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022895] [ENSMUST00000161405]
Predicted Effect probably damaging
Transcript: ENSMUST00000022895
AA Change: N400T

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022895
Gene: ENSMUSG00000022286
AA Change: N400T

DomainStartEndE-ValueType
Pfam:CP2 214 438 8.5e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161405
AA Change: N400T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125410
Gene: ENSMUSG00000022286
AA Change: N400T

DomainStartEndE-ValueType
Pfam:CP2 209 434 2.1e-79 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that can act as a homodimer or as a heterodimer with either GRHL1 or GRHL3. Defects in this gene are a cause of non-syndromic sensorineural deafness autosomal dominant type 28 (DFNA28).[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with cranioschisis, facial cleft, impaired neural fold elevation, and an open posterior neuropore. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,218,952 Q651L probably benign Het
Adam8 C T 7: 139,985,430 V624I probably damaging Het
Ccdc144b T A 3: 36,046,876 Q49L probably damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Cmya5 T C 13: 93,083,212 K3243R possibly damaging Het
Dock5 G A 14: 67,786,340 T1124M possibly damaging Het
Fam8a1 A T 13: 46,671,247 M237L probably benign Het
Fars2 G T 13: 36,204,775 K82N probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm5767 C T 16: 8,683,646 P59L unknown Het
Gnat3 A G 5: 18,003,772 D158G Het
Grin2c A T 11: 115,256,259 probably null Het
Hipk4 A G 7: 27,523,548 Y11C probably damaging Het
Hspa9 G T 18: 34,938,687 A620E not run Het
Igkv12-89 A G 6: 68,835,099 S29P probably benign Het
Itga8 A T 2: 12,109,187 D1039E probably damaging Het
Itgae A T 11: 73,113,631 D248V probably damaging Het
Kmt2c T C 5: 25,315,095 K2006E probably damaging Het
Mdga1 C T 17: 29,832,379 G934R probably benign Het
Mov10 T C 3: 104,795,885 N896S probably benign Het
Ndufb6 A T 4: 40,273,080 probably null Het
Nlk T C 11: 78,591,005 probably null Het
Notch2 T A 3: 98,146,623 S2201T probably damaging Het
Olfr152 A T 2: 87,783,434 D298V probably damaging Het
Pank1 A C 19: 34,821,988 probably null Het
Pdlim3 T C 8: 45,909,065 F126S probably damaging Het
Pds5a C A 5: 65,638,604 G648C probably benign Het
Plekhh3 T C 11: 101,164,327 I567V unknown Het
Ppfia2 T C 10: 106,865,403 probably null Het
Prl3d1 A G 13: 27,100,069 D207G probably damaging Het
Prss23 T A 7: 89,510,246 D205V probably benign Het
Pygl C T 12: 70,197,795 probably null Het
Qsox2 A G 2: 26,221,020 F111S probably damaging Het
Sart3 T C 5: 113,771,352 N95S probably benign Het
Scpep1 A G 11: 88,929,220 F414S probably damaging Het
Selenbp1 C A 3: 94,937,348 Y105* probably null Het
Sirpa A G 2: 129,616,445 D327G probably benign Het
Sowahc G A 10: 59,222,183 R47H probably damaging Het
Szt2 T C 4: 118,393,828 Y361C probably damaging Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tie1 T C 4: 118,472,978 I1042M probably damaging Het
Tmem132e T A 11: 82,434,516 L114Q probably damaging Het
Tmx3 A G 18: 90,537,109 T317A probably damaging Het
Tppp3 A G 8: 105,468,292 V69A probably benign Het
Tpr T C 1: 150,423,516 Y1156H probably damaging Het
Trank1 A C 9: 111,365,296 D796A possibly damaging Het
Tsc2 G A 17: 24,607,492 P928S probably benign Het
Unc80 G T 1: 66,672,684 V2722F possibly damaging Het
Vmn1r199 G T 13: 22,382,675 L46F probably benign Het
Vps13a A T 19: 16,750,149 H196Q probably benign Het
Wnt10a T A 1: 74,793,474 C75* probably null Het
Zfp335 A G 2: 164,892,539 probably null Het
Other mutations in Grhl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Grhl2 APN 15 37336301 missense probably damaging 1.00
IGL01730:Grhl2 APN 15 37337774 missense probably benign 0.00
IGL02140:Grhl2 APN 15 37270586 splice site probably benign
IGL02307:Grhl2 APN 15 37288288 missense probably damaging 1.00
IGL02375:Grhl2 APN 15 37291577 missense probably damaging 1.00
IGL02508:Grhl2 APN 15 37309765 splice site probably benign
clayton UTSW 15 37291676 splice site probably null
R0462:Grhl2 UTSW 15 37344675 missense probably benign 0.00
R1421:Grhl2 UTSW 15 37309716 missense probably damaging 1.00
R1548:Grhl2 UTSW 15 37336323 missense probably benign 0.32
R1912:Grhl2 UTSW 15 37358407 missense probably damaging 1.00
R1960:Grhl2 UTSW 15 37336314 missense probably damaging 1.00
R3110:Grhl2 UTSW 15 37336347 critical splice donor site probably null
R3112:Grhl2 UTSW 15 37336347 critical splice donor site probably null
R4261:Grhl2 UTSW 15 37360823 missense possibly damaging 0.64
R4830:Grhl2 UTSW 15 37335659 splice site probably null
R4910:Grhl2 UTSW 15 37291676 splice site probably null
R4929:Grhl2 UTSW 15 37360802 missense probably benign
R4952:Grhl2 UTSW 15 37287249 missense probably benign 0.13
R5742:Grhl2 UTSW 15 37328372 missense probably damaging 1.00
R7142:Grhl2 UTSW 15 37279582 missense probably benign 0.05
R7208:Grhl2 UTSW 15 37335736 missense probably damaging 1.00
R7466:Grhl2 UTSW 15 37291616 missense probably damaging 1.00
R7519:Grhl2 UTSW 15 37336312 missense probably damaging 1.00
R7538:Grhl2 UTSW 15 37328359 missense probably damaging 1.00
R8027:Grhl2 UTSW 15 37279483 missense probably benign
R8047:Grhl2 UTSW 15 37336221 missense probably benign 0.00
Z1177:Grhl2 UTSW 15 37333287 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTTGTCCTTACAGGTCCACG -3'
(R):5'- TGCTTCCATAGGATAGCCAAATG -3'

Sequencing Primer
(F):5'- TTACAGGTCCACGTGCGACTC -3'
(R):5'- TGACTCTCTAGACACCGCTAG -3'
Posted On2019-10-24