Incidental Mutation 'R7638:Casq2'
ID590042
Institutional Source Beutler Lab
Gene Symbol Casq2
Ensembl Gene ENSMUSG00000027861
Gene Namecalsequestrin 2
SynonymsESTM52, cCSQ, cardiac calsequestrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7638 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location102086415-102146514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102086700 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 21 (E21G)
Ref Sequence ENSEMBL: ENSMUSP00000130482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029454] [ENSMUST00000164123] [ENSMUST00000165540]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029454
AA Change: E21G

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029454
Gene: ENSMUSG00000027861
AA Change: E21G

DomainStartEndE-ValueType
Pfam:Calsequestrin 1 382 1.4e-226 PFAM
Pfam:Thioredoxin_6 171 364 7e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164123
AA Change: E21G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131232
Gene: ENSMUSG00000027861
AA Change: E21G

DomainStartEndE-ValueType
Pfam:Calsequestrin 2 108 1.3e-46 PFAM
Pfam:Thioredoxin_6 101 293 6.1e-20 PFAM
Pfam:Calsequestrin 106 311 1.9e-127 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165540
AA Change: E21G

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130482
Gene: ENSMUSG00000027861
AA Change: E21G

DomainStartEndE-ValueType
Pfam:Calsequestrin 1 386 7.4e-224 PFAM
Pfam:Thioredoxin_6 171 367 9.1e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene specifies the cardiac muscle family member of the calsequestrin family. Calsequestrin is localized to the sarcoplasmic reticulum in cardiac and slow skeletal muscle cells. The protein is a calcium binding protein that stores calcium for muscle function. Mutations in this gene cause stress-induced polymorphic ventricular tachycardia, also referred to as catecholaminergic polymorphic ventricular tachycardia 2 (CPVT2), a disease characterized by bidirectional ventricular tachycardia that may lead to cardiac arrest. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene cause impaired intracellular calcium regulation in cardiac myocytes and lead to an arrhythmogenic syndrome called catecholaminergic polymorphic ventricular tachycardia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,320,917 V161A probably damaging Het
Abo T G 2: 26,843,843 T115P probably damaging Het
Aggf1 G A 13: 95,356,413 R563* probably null Het
Amdhd1 A T 10: 93,534,498 Y159* probably null Het
BC027072 T C 17: 71,750,885 D599G probably damaging Het
C77080 T C 4: 129,221,941 T1022A probably benign Het
Camp T C 9: 109,848,393 E124G Het
Cbln1 A T 8: 87,471,729 F116Y probably damaging Het
Cklf A T 8: 104,263,364 K143* probably null Het
Clca3a1 A G 3: 144,751,962 I387T probably damaging Het
Cndp1 T A 18: 84,636,049 D130V probably benign Het
Cyp4a12a T A 4: 115,327,473 M317K possibly damaging Het
D13Ertd608e A T 13: 119,842,688 probably null Het
Dmxl2 A T 9: 54,457,794 I138K unknown Het
Eapp A G 12: 54,673,723 S236P probably benign Het
Efnb3 T C 11: 69,557,220 H132R possibly damaging Het
Fbn2 A T 18: 58,105,136 N596K probably damaging Het
Fzd9 A G 5: 135,250,630 W134R probably damaging Het
Gga2 A G 7: 122,003,934 S180P probably damaging Het
Gm11639 T A 11: 105,036,799 M4798K probably benign Het
Gm30302 G T 13: 49,786,975 Q420K probably benign Het
Golga3 A G 5: 110,205,828 T911A probably benign Het
Gstm1 C T 3: 108,014,550 probably null Het
Heg1 A G 16: 33,727,497 T909A probably damaging Het
Herc2 T C 7: 56,157,438 S2455P probably benign Het
Herc2 C T 7: 56,220,525 R4349W probably damaging Het
Hivep2 T G 10: 14,143,851 M2122R possibly damaging Het
Itga10 T A 3: 96,657,391 probably null Het
Kbtbd13 G T 9: 65,391,323 C110* probably null Het
Krt78 T C 15: 101,950,883 E293G probably damaging Het
Lgals3bp C T 11: 118,398,169 V110M possibly damaging Het
Lrp2 A G 2: 69,477,008 probably null Het
Lrrc14 A G 15: 76,713,973 D301G probably benign Het
Lrrc71 C A 3: 87,741,806 G352W probably damaging Het
Map3k9 A G 12: 81,724,732 V694A probably benign Het
Mboat2 T C 12: 24,939,326 S162P probably damaging Het
Megf11 C A 9: 64,679,253 N422K probably damaging Het
Miga1 C T 3: 152,276,687 S584N probably benign Het
Mindy2 A G 9: 70,616,859 Y403H probably damaging Het
Mmd C T 11: 90,276,757 A204V possibly damaging Het
Mta3 A T 17: 83,800,143 Y262F probably benign Het
Ncoa7 G A 10: 30,722,798 S43F probably benign Het
Nphp4 T C 4: 152,554,534 V874A probably benign Het
Nsd1 A G 13: 55,312,328 T2226A probably benign Het
Nt5dc1 T C 10: 34,314,796 H302R probably benign Het
Odc1 A G 12: 17,550,002 Y389C probably damaging Het
Olfr175-ps1 G A 16: 58,824,595 T38I probably damaging Het
Olfr551 A G 7: 102,587,918 I275T probably damaging Het
Olfr970 T G 9: 39,819,893 F85V probably damaging Het
Pcdhb10 A C 18: 37,412,312 Q147P probably benign Het
Pdcl2 A C 5: 76,317,828 C182G probably damaging Het
Pigv T C 4: 133,665,451 D136G possibly damaging Het
Pramel5 T C 4: 144,271,440 E411G possibly damaging Het
Prkce T C 17: 86,168,600 V3A probably benign Het
Pth1r T C 9: 110,722,393 N546S probably benign Het
Qrich2 C T 11: 116,455,322 V1559I probably benign Het
Rbm20 A C 19: 53,814,333 D424A possibly damaging Het
Rbm26 C T 14: 105,150,848 D393N probably damaging Het
Sf3b3 G A 8: 110,820,813 R728C probably damaging Het
Srcap A G 7: 127,538,748 N1090S probably benign Het
Syt4 A T 18: 31,443,822 S160T probably benign Het
Tfap2e C T 4: 126,721,934 V236M probably damaging Het
Thsd4 G A 9: 60,394,472 T180M probably damaging Het
Tlr4 T A 4: 66,840,206 M412K probably damaging Het
Tmem67 T A 4: 12,079,883 H136L probably benign Het
Tnpo2 T A 8: 85,044,415 I110N probably benign Het
Trav13d-3 A G 14: 53,033,413 M111V probably benign Het
Tubb3 A T 8: 123,421,161 S278C probably benign Het
Ugcg T A 4: 59,220,299 F364Y probably benign Het
Usp17lc T C 7: 103,418,499 S334P probably damaging Het
Vps13c A G 9: 67,945,509 D2357G probably damaging Het
Zfp157 T C 5: 138,455,910 Y125H probably benign Het
Zfp747 A T 7: 127,374,647 M117K probably benign Het
Znrd1 A C 17: 36,957,830 probably null Het
Zscan4c A T 7: 11,009,731 N419I possibly damaging Het
Other mutations in Casq2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Casq2 APN 3 102110231 splice site probably benign
IGL02597:Casq2 APN 3 102126637 missense probably damaging 1.00
IGL02863:Casq2 APN 3 102144175 missense possibly damaging 0.84
IGL02902:Casq2 APN 3 102086797 nonsense probably null
IGL03176:Casq2 APN 3 102126654 missense possibly damaging 0.50
R0126:Casq2 UTSW 3 102133399 missense probably damaging 1.00
R0653:Casq2 UTSW 3 102113166 critical splice donor site probably null
R1036:Casq2 UTSW 3 102142215 missense probably damaging 1.00
R1052:Casq2 UTSW 3 102144234 splice site probably null
R1158:Casq2 UTSW 3 102116883 missense probably damaging 1.00
R2886:Casq2 UTSW 3 102144218 missense probably damaging 1.00
R3001:Casq2 UTSW 3 102145201 missense probably damaging 0.99
R3002:Casq2 UTSW 3 102145201 missense probably damaging 0.99
R4155:Casq2 UTSW 3 102133102 splice site probably null
R4715:Casq2 UTSW 3 102110244 missense probably benign 0.00
R6013:Casq2 UTSW 3 102145629 unclassified probably null
R6778:Casq2 UTSW 3 102127931 splice site probably null
R6836:Casq2 UTSW 3 102086760 missense probably damaging 1.00
R6844:Casq2 UTSW 3 102110262 missense possibly damaging 0.70
R7055:Casq2 UTSW 3 102142245 missense probably damaging 1.00
R7761:Casq2 UTSW 3 102145264 missense probably damaging 1.00
R7997:Casq2 UTSW 3 102086842 missense probably damaging 0.98
R8169:Casq2 UTSW 3 102110312 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CATGTGTGCATTTGAGCCTCC -3'
(R):5'- CCAGTACAATCTCCTTCAGCTG -3'

Sequencing Primer
(F):5'- GAGCCTCCACAGTTTGTTCTGAG -3'
(R):5'- AGTACAATCTCCTTCAGCTGGAACTG -3'
Posted On2019-10-24