Incidental Mutation 'R7638:Tmem67'
ID590045
Institutional Source Beutler Lab
Gene Symbol Tmem67
Ensembl Gene ENSMUSG00000049488
Gene Nametransmembrane protein 67
Synonymsb2b1291.1Clo, 5330408M12Rik, b2b1163.1Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7638 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location12039355-12090020 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12079883 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 136 (H136L)
Ref Sequence ENSEMBL: ENSMUSP00000052644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050686] [ENSMUST00000108293]
Predicted Effect probably benign
Transcript: ENSMUST00000050686
AA Change: H136L

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000052644
Gene: ENSMUSG00000049488
AA Change: H136L

DomainStartEndE-ValueType
low complexity region 17 23 N/A INTRINSIC
Pfam:Meckelin 166 995 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108293
AA Change: H202L

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103928
Gene: ENSMUSG00000049488
AA Change: H202L

DomainStartEndE-ValueType
low complexity region 83 89 N/A INTRINSIC
Pfam:Meckelin 236 1061 N/A PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000115154
Gene: ENSMUSG00000049488
AA Change: H133L

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the primary cilium and to the plasma membrane. The gene functions in centriole migration to the apical membrane and formation of the primary cilium. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Meckel syndrome type 3 (MKS3) and Joubert syndrome type 6 (JBTS6). [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit neonatal/postanal lethality, kidney cysts, and Meckel-Gruber or Joubert syndrome-like phenotypes depending on the filial generation of the backcross to C57BL/6J. Mice homozygous for an ENU-induced allele exhibit cardiovascular defects and cystic kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,320,917 V161A probably damaging Het
Abo T G 2: 26,843,843 T115P probably damaging Het
Aggf1 G A 13: 95,356,413 R563* probably null Het
Amdhd1 A T 10: 93,534,498 Y159* probably null Het
BC027072 T C 17: 71,750,885 D599G probably damaging Het
C77080 T C 4: 129,221,941 T1022A probably benign Het
Camp T C 9: 109,848,393 E124G Het
Casq2 A G 3: 102,086,700 E21G possibly damaging Het
Cbln1 A T 8: 87,471,729 F116Y probably damaging Het
Cklf A T 8: 104,263,364 K143* probably null Het
Clca3a1 A G 3: 144,751,962 I387T probably damaging Het
Cndp1 T A 18: 84,636,049 D130V probably benign Het
Cyp4a12a T A 4: 115,327,473 M317K possibly damaging Het
D13Ertd608e A T 13: 119,842,688 probably null Het
Dmxl2 A T 9: 54,457,794 I138K unknown Het
Eapp A G 12: 54,673,723 S236P probably benign Het
Efnb3 T C 11: 69,557,220 H132R possibly damaging Het
Fbn2 A T 18: 58,105,136 N596K probably damaging Het
Fzd9 A G 5: 135,250,630 W134R probably damaging Het
Gga2 A G 7: 122,003,934 S180P probably damaging Het
Gm11639 T A 11: 105,036,799 M4798K probably benign Het
Gm30302 G T 13: 49,786,975 Q420K probably benign Het
Golga3 A G 5: 110,205,828 T911A probably benign Het
Gstm1 C T 3: 108,014,550 probably null Het
Heg1 A G 16: 33,727,497 T909A probably damaging Het
Herc2 T C 7: 56,157,438 S2455P probably benign Het
Herc2 C T 7: 56,220,525 R4349W probably damaging Het
Hivep2 T G 10: 14,143,851 M2122R possibly damaging Het
Itga10 T A 3: 96,657,391 probably null Het
Kbtbd13 G T 9: 65,391,323 C110* probably null Het
Krt78 T C 15: 101,950,883 E293G probably damaging Het
Lgals3bp C T 11: 118,398,169 V110M possibly damaging Het
Lrp2 A G 2: 69,477,008 probably null Het
Lrrc14 A G 15: 76,713,973 D301G probably benign Het
Lrrc71 C A 3: 87,741,806 G352W probably damaging Het
Map3k9 A G 12: 81,724,732 V694A probably benign Het
Mboat2 T C 12: 24,939,326 S162P probably damaging Het
Megf11 C A 9: 64,679,253 N422K probably damaging Het
Miga1 C T 3: 152,276,687 S584N probably benign Het
Mindy2 A G 9: 70,616,859 Y403H probably damaging Het
Mmd C T 11: 90,276,757 A204V possibly damaging Het
Mta3 A T 17: 83,800,143 Y262F probably benign Het
Ncoa7 G A 10: 30,722,798 S43F probably benign Het
Nphp4 T C 4: 152,554,534 V874A probably benign Het
Nsd1 A G 13: 55,312,328 T2226A probably benign Het
Nt5dc1 T C 10: 34,314,796 H302R probably benign Het
Odc1 A G 12: 17,550,002 Y389C probably damaging Het
Olfr175-ps1 G A 16: 58,824,595 T38I probably damaging Het
Olfr551 A G 7: 102,587,918 I275T probably damaging Het
Olfr970 T G 9: 39,819,893 F85V probably damaging Het
Pcdhb10 A C 18: 37,412,312 Q147P probably benign Het
Pdcl2 A C 5: 76,317,828 C182G probably damaging Het
Pigv T C 4: 133,665,451 D136G possibly damaging Het
Pramel5 T C 4: 144,271,440 E411G possibly damaging Het
Prkce T C 17: 86,168,600 V3A probably benign Het
Pth1r T C 9: 110,722,393 N546S probably benign Het
Qrich2 C T 11: 116,455,322 V1559I probably benign Het
Rbm20 A C 19: 53,814,333 D424A possibly damaging Het
Rbm26 C T 14: 105,150,848 D393N probably damaging Het
Sf3b3 G A 8: 110,820,813 R728C probably damaging Het
Srcap A G 7: 127,538,748 N1090S probably benign Het
Syt4 A T 18: 31,443,822 S160T probably benign Het
Tfap2e C T 4: 126,721,934 V236M probably damaging Het
Thsd4 G A 9: 60,394,472 T180M probably damaging Het
Tlr4 T A 4: 66,840,206 M412K probably damaging Het
Tnpo2 T A 8: 85,044,415 I110N probably benign Het
Trav13d-3 A G 14: 53,033,413 M111V probably benign Het
Tubb3 A T 8: 123,421,161 S278C probably benign Het
Ugcg T A 4: 59,220,299 F364Y probably benign Het
Usp17lc T C 7: 103,418,499 S334P probably damaging Het
Vps13c A G 9: 67,945,509 D2357G probably damaging Het
Zfp157 T C 5: 138,455,910 Y125H probably benign Het
Zfp747 A T 7: 127,374,647 M117K probably benign Het
Znrd1 A C 17: 36,957,830 probably null Het
Zscan4c A T 7: 11,009,731 N419I possibly damaging Het
Other mutations in Tmem67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Tmem67 APN 4 12061826 missense probably damaging 0.98
IGL00768:Tmem67 APN 4 12055029 critical splice donor site probably null
IGL00813:Tmem67 APN 4 12058587 splice site probably benign
IGL01070:Tmem67 APN 4 12054750 missense probably benign 0.20
IGL01088:Tmem67 APN 4 12063126 missense probably damaging 1.00
IGL01353:Tmem67 APN 4 12079895 missense probably damaging 1.00
IGL01490:Tmem67 APN 4 12057422 splice site probably benign
IGL01885:Tmem67 APN 4 12057389 missense probably damaging 1.00
IGL02061:Tmem67 APN 4 12053526 missense probably damaging 1.00
IGL02151:Tmem67 APN 4 12068882 missense probably benign 0.35
IGL02166:Tmem67 APN 4 12047313 missense possibly damaging 0.90
IGL02243:Tmem67 APN 4 12070584 missense possibly damaging 0.93
IGL02517:Tmem67 APN 4 12069463 missense possibly damaging 0.67
IGL02736:Tmem67 APN 4 12045789 splice site probably null
R0282:Tmem67 UTSW 4 12087930 missense probably damaging 0.99
R0514:Tmem67 UTSW 4 12089317 missense probably benign
R1221:Tmem67 UTSW 4 12045871 missense possibly damaging 0.92
R1301:Tmem67 UTSW 4 12089400 unclassified probably benign
R1581:Tmem67 UTSW 4 12047814 missense probably damaging 1.00
R1680:Tmem67 UTSW 4 12087840 missense probably benign 0.00
R1804:Tmem67 UTSW 4 12045789 splice site probably null
R2174:Tmem67 UTSW 4 12063730 nonsense probably null
R2191:Tmem67 UTSW 4 12069413 critical splice donor site probably null
R2246:Tmem67 UTSW 4 12040651 missense probably damaging 1.00
R2566:Tmem67 UTSW 4 12079918 missense probably damaging 0.99
R3409:Tmem67 UTSW 4 12073952 missense probably benign 0.00
R3410:Tmem67 UTSW 4 12073952 missense probably benign 0.00
R4078:Tmem67 UTSW 4 12040633 critical splice donor site probably null
R4282:Tmem67 UTSW 4 12073922 missense probably damaging 0.99
R4429:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4430:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4431:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4734:Tmem67 UTSW 4 12063158 missense probably benign 0.00
R4856:Tmem67 UTSW 4 12089416 unclassified probably benign
R4865:Tmem67 UTSW 4 12070262 missense probably benign 0.01
R5056:Tmem67 UTSW 4 12070471 missense probably benign 0.29
R5575:Tmem67 UTSW 4 12047886 missense possibly damaging 0.93
R5614:Tmem67 UTSW 4 12061755 missense possibly damaging 0.54
R6030:Tmem67 UTSW 4 12063799 missense probably benign 0.01
R6030:Tmem67 UTSW 4 12063799 missense probably benign 0.01
R6182:Tmem67 UTSW 4 12051402 missense probably benign 0.05
R6562:Tmem67 UTSW 4 12053445 critical splice donor site probably null
R6574:Tmem67 UTSW 4 12063086 missense possibly damaging 0.70
R6696:Tmem67 UTSW 4 12061754 critical splice donor site probably null
R6824:Tmem67 UTSW 4 12051449 missense probably damaging 1.00
R7028:Tmem67 UTSW 4 12075484 missense probably benign 0.12
R7174:Tmem67 UTSW 4 12077337 missense possibly damaging 0.82
R7369:Tmem67 UTSW 4 12053535 missense probably damaging 1.00
R7671:Tmem67 UTSW 4 12063698 missense probably benign 0.00
R7736:Tmem67 UTSW 4 12053455 missense probably benign 0.09
R7920:Tmem67 UTSW 4 12089284 critical splice donor site probably null
R7981:Tmem67 UTSW 4 12070592 missense probably damaging 1.00
R8005:Tmem67 UTSW 4 12047821 missense probably damaging 1.00
R8086:Tmem67 UTSW 4 12040738 missense probably damaging 1.00
R8196:Tmem67 UTSW 4 12075661 missense probably benign 0.00
R8344:Tmem67 UTSW 4 12058576 missense probably benign 0.00
R8350:Tmem67 UTSW 4 12087891 missense probably benign 0.07
R8450:Tmem67 UTSW 4 12087891 missense probably benign 0.07
Z1176:Tmem67 UTSW 4 12087983 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCTGAGTCTAACAGTTTCTATCC -3'
(R):5'- TGGCATGTAATAAACCCACTTGG -3'

Sequencing Primer
(F):5'- CAAGTATTGACAGTAACAGACATGC -3'
(R):5'- TAAAGATGGCTGGGACTG -3'
Posted On2019-10-24