Mutagenetix > Incidental Mutation

Incidental Mutation 'R7638:Tlr4'

590047

Institutional Source

Beutler Lab

Gene Symbol

Tlr4

Ensembl Gene

ENSMUSG00000039005

Gene Name

toll-like receptor 4

Synonyms

Rasl2-8, Lps, lipopolysaccharide response

MMRRC Submission

045696-MU

Accession Numbers

MGI: 96824

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7638 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66827584-66930284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 66840206 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 412 (M412K)

Ref Sequence

ENSEMBL: ENSMUSP00000045770 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048096] [ENSMUST00000107365]

AlphaFold

Q9QUK6

PDB Structure

Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048096
AA Change: M412K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005
AA Change: M412K

Domain	Start	End	E-Value	Type
LRR	76	99	7.36e0	SMART
LRR	100	123	1.86e0	SMART
LRR	173	196	8.24e0	SMART
LRR	370	401	4.33e1	SMART
LRR	468	492	2.54e2	SMART
LRR	493	516	1.86e2	SMART
LRR	517	540	1.67e2	SMART
LRR	541	563	1.92e2	SMART
LRRCT	576	626	4.74e-3	SMART
transmembrane domain	636	658	N/A	INTRINSIC
TIR	671	816	7.3e-39	SMART
low complexity region	822	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107365

SMART Domains

Protein: ENSMUSP00000102988
Gene: ENSMUSG00000039005

Domain	Start	End	E-Value	Type
PDB:3VQ2\|B	22	86	2e-38	PDB
SCOP:d1m0za_	27	86	4e-6	SMART

Meta Mutation Damage Score

0.3105

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted(2) Spontaneous(6) Chemically induced(2)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563D23Rik	A	G	16: 92,320,917	V161A	probably damaging	Het
Abo	T	G	2: 26,843,843	T115P	probably damaging	Het
Aggf1	G	A	13: 95,356,413	R563*	probably null	Het
Amdhd1	A	T	10: 93,534,498	Y159*	probably null	Het
BC027072	T	C	17: 71,750,885	D599G	probably damaging	Het
C77080	T	C	4: 129,221,941	T1022A	probably benign	Het
Camp	T	C	9: 109,848,393	E124G		Het
Casq2	A	G	3: 102,086,700	E21G	possibly damaging	Het
Cbln1	A	T	8: 87,471,729	F116Y	probably damaging	Het
Cklf	A	T	8: 104,263,364	K143*	probably null	Het
Clca3a1	A	G	3: 144,751,962	I387T	probably damaging	Het
Cndp1	T	A	18: 84,636,049	D130V	probably benign	Het
Cyp4a12a	T	A	4: 115,327,473	M317K	possibly damaging	Het
D13Ertd608e	A	T	13: 119,842,688		probably null	Het
Dmxl2	A	T	9: 54,457,794	I138K	unknown	Het
Eapp	A	G	12: 54,673,723	S236P	probably benign	Het
Efnb3	T	C	11: 69,557,220	H132R	possibly damaging	Het
Fbn2	A	T	18: 58,105,136	N596K	probably damaging	Het
Fzd9	A	G	5: 135,250,630	W134R	probably damaging	Het
Gga2	A	G	7: 122,003,934	S180P	probably damaging	Het
Gm11639	T	A	11: 105,036,799	M4798K	probably benign	Het
Gm30302	G	T	13: 49,786,975	Q420K	probably benign	Het
Golga3	A	G	5: 110,205,828	T911A	probably benign	Het
Gstm1	C	T	3: 108,014,550		probably null	Het
Heg1	A	G	16: 33,727,497	T909A	probably damaging	Het
Herc2	T	C	7: 56,157,438	S2455P	probably benign	Het
Herc2	C	T	7: 56,220,525	R4349W	probably damaging	Het
Hivep2	T	G	10: 14,143,851	M2122R	possibly damaging	Het
Itga10	T	A	3: 96,657,391		probably null	Het
Kbtbd13	G	T	9: 65,391,323	C110*	probably null	Het
Krt78	T	C	15: 101,950,883	E293G	probably damaging	Het
Lgals3bp	C	T	11: 118,398,169	V110M	possibly damaging	Het
Lrp2	A	G	2: 69,477,008		probably null	Het
Lrrc14	A	G	15: 76,713,973	D301G	probably benign	Het
Lrrc71	C	A	3: 87,741,806	G352W	probably damaging	Het
Map3k9	A	G	12: 81,724,732	V694A	probably benign	Het
Mboat2	T	C	12: 24,939,326	S162P	probably damaging	Het
Megf11	C	A	9: 64,679,253	N422K	probably damaging	Het
Miga1	C	T	3: 152,276,687	S584N	probably benign	Het
Mindy2	A	G	9: 70,616,859	Y403H	probably damaging	Het
Mmd	C	T	11: 90,276,757	A204V	possibly damaging	Het
Mta3	A	T	17: 83,800,143	Y262F	probably benign	Het
Ncoa7	G	A	10: 30,722,798	S43F	probably benign	Het
Nphp4	T	C	4: 152,554,534	V874A	probably benign	Het
Nsd1	A	G	13: 55,312,328	T2226A	probably benign	Het
Nt5dc1	T	C	10: 34,314,796	H302R	probably benign	Het
Odc1	A	G	12: 17,550,002	Y389C	probably damaging	Het
Olfr175-ps1	G	A	16: 58,824,595	T38I	probably damaging	Het
Olfr551	A	G	7: 102,587,918	I275T	probably damaging	Het
Olfr970	T	G	9: 39,819,893	F85V	probably damaging	Het
Pcdhb10	A	C	18: 37,412,312	Q147P	probably benign	Het
Pdcl2	A	C	5: 76,317,828	C182G	probably damaging	Het
Pigv	T	C	4: 133,665,451	D136G	possibly damaging	Het
Pramel5	T	C	4: 144,271,440	E411G	possibly damaging	Het
Prkce	T	C	17: 86,168,600	V3A	probably benign	Het
Pth1r	T	C	9: 110,722,393	N546S	probably benign	Het
Qrich2	C	T	11: 116,455,322	V1559I	probably benign	Het
Rbm20	A	C	19: 53,814,333	D424A	possibly damaging	Het
Rbm26	C	T	14: 105,150,848	D393N	probably damaging	Het
Sf3b3	G	A	8: 110,820,813	R728C	probably damaging	Het
Srcap	A	G	7: 127,538,748	N1090S	probably benign	Het
Syt4	A	T	18: 31,443,822	S160T	probably benign	Het
Tfap2e	C	T	4: 126,721,934	V236M	probably damaging	Het
Thsd4	G	A	9: 60,394,472	T180M	probably damaging	Het
Tmem67	T	A	4: 12,079,883	H136L	probably benign	Het
Tnpo2	T	A	8: 85,044,415	I110N	probably benign	Het
Trav13d-3	A	G	14: 53,033,413	M111V	probably benign	Het
Tubb3	A	T	8: 123,421,161	S278C	probably benign	Het
Ugcg	T	A	4: 59,220,299	F364Y	probably benign	Het
Usp17lc	T	C	7: 103,418,499	S334P	probably damaging	Het
Vps13c	A	G	9: 67,945,509	D2357G	probably damaging	Het
Zfp157	T	C	5: 138,455,910	Y125H	probably benign	Het
Zfp747	A	T	7: 127,374,647	M117K	probably benign	Het
Znrd1	A	C	17: 36,957,830		probably null	Het
Zscan4c	A	T	7: 11,009,731	N419I	possibly damaging	Het

Other mutations in Tlr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01120:Tlr4	APN	4	66840425	missense	probably benign	0.01
IGL01343:Tlr4	APN	4	66833887	splice site	probably benign
IGL01669:Tlr4	APN	4	66841267	missense	possibly damaging	0.48
IGL01875:Tlr4	APN	4	66839489	missense	probably damaging	1.00
IGL02138:Tlr4	APN	4	66840965	missense	probably damaging	0.99
IGL02244:Tlr4	APN	4	66834061	critical splice donor site	probably null
IGL02793:Tlr4	APN	4	66839444	missense	probably damaging	1.00
IGL03269:Tlr4	APN	4	66840796	missense	probably damaging	1.00
IGL03288:Tlr4	APN	4	66839753	missense	probably damaging	0.99
bugsy	UTSW	4	66839254	nonsense	probably null
Cruyff	UTSW	4	66840326	missense	probably damaging	1.00
don_knotts	UTSW	4	66841172	missense	probably damaging	1.00
Guardiola	UTSW	4	66839303	missense	probably damaging	1.00
Lops	UTSW	4	66833880	splice site	probably null
lps3	UTSW	4	66841097	missense	probably damaging	1.00
Lps4	UTSW	4	66841142	missense	probably damaging	1.00
milquetoast	UTSW	4	66839444	missense	probably damaging	1.00
salvador	UTSW	4	66840206	missense	probably damaging	0.99
R0449:Tlr4	UTSW	4	66839620	missense	probably damaging	0.99
R0481:Tlr4	UTSW	4	66827916	missense	probably benign	0.05
R0576:Tlr4	UTSW	4	66839495	missense	probably benign	0.00
R0827:Tlr4	UTSW	4	66833880	splice site	probably null
R1488:Tlr4	UTSW	4	66839549	missense	probably damaging	1.00
R1490:Tlr4	UTSW	4	66839374	missense	possibly damaging	0.56
R1522:Tlr4	UTSW	4	66839696	missense	possibly damaging	0.80
R1616:Tlr4	UTSW	4	66839480	missense	probably damaging	1.00
R1681:Tlr4	UTSW	4	66841105	missense	probably damaging	1.00
R1738:Tlr4	UTSW	4	66841076	missense	probably benign	0.19
R1888:Tlr4	UTSW	4	66841172	missense	probably damaging	1.00
R1888:Tlr4	UTSW	4	66841172	missense	probably damaging	1.00
R1929:Tlr4	UTSW	4	66839444	missense	probably damaging	1.00
R1982:Tlr4	UTSW	4	66841035	missense	probably benign	0.40
R1998:Tlr4	UTSW	4	66840470	missense	probably damaging	1.00
R2186:Tlr4	UTSW	4	66839983	missense	possibly damaging	0.63
R2305:Tlr4	UTSW	4	66840101	missense	probably damaging	1.00
R3011:Tlr4	UTSW	4	66839254	nonsense	probably null
R3420:Tlr4	UTSW	4	66839536	missense	probably benign	0.37
R3422:Tlr4	UTSW	4	66839536	missense	probably benign	0.37
R3818:Tlr4	UTSW	4	66841316	missense	probably benign	0.00
R4212:Tlr4	UTSW	4	66840326	missense	probably damaging	1.00
R4213:Tlr4	UTSW	4	66840326	missense	probably damaging	1.00
R4417:Tlr4	UTSW	4	66839303	missense	probably damaging	1.00
R4630:Tlr4	UTSW	4	66839240	missense	probably benign	0.44
R4735:Tlr4	UTSW	4	66841198	missense	probably damaging	1.00
R5191:Tlr4	UTSW	4	66841379	missense	probably damaging	0.96
R5613:Tlr4	UTSW	4	66840885	missense	possibly damaging	0.94
R5705:Tlr4	UTSW	4	66833980	missense	probably damaging	1.00
R5726:Tlr4	UTSW	4	66840415	missense	probably benign
R6021:Tlr4	UTSW	4	66840866	missense	probably damaging	1.00
R6159:Tlr4	UTSW	4	66839833	missense	possibly damaging	0.92
R6227:Tlr4	UTSW	4	66840595	missense	probably benign
R7139:Tlr4	UTSW	4	66840283	missense	probably benign	0.06
R7199:Tlr4	UTSW	4	66841193	missense	probably damaging	0.99
R7220:Tlr4	UTSW	4	66839951	missense	probably benign
R7337:Tlr4	UTSW	4	66839954	missense	possibly damaging	0.86
R7487:Tlr4	UTSW	4	66924422	missense	probably benign	0.00
R7773:Tlr4	UTSW	4	66839599	missense	probably damaging	1.00
R7814:Tlr4	UTSW	4	66841079	missense	probably damaging	1.00
R7897:Tlr4	UTSW	4	66839821	missense	probably benign	0.07
R8044:Tlr4	UTSW	4	66827847	missense	probably benign	0.01
R8062:Tlr4	UTSW	4	66839850	missense	probably benign	0.00
R8080:Tlr4	UTSW	4	66839476	missense	probably damaging	1.00
R8446:Tlr4	UTSW	4	66839436	missense	probably damaging	0.98
R8916:Tlr4	UTSW	4	66929031	missense	probably benign	0.06
R9100:Tlr4	UTSW	4	66840281	missense	probably benign	0.08
R9415:Tlr4	UTSW	4	66827923	critical splice donor site	probably null
R9562:Tlr4	UTSW	4	66841285	missense	possibly damaging	0.80
R9565:Tlr4	UTSW	4	66841285	missense	possibly damaging	0.80
R9752:Tlr4	UTSW	4	66839675	missense	probably benign	0.02
X0064:Tlr4	UTSW	4	66840140	missense	probably damaging	0.99
Z1088:Tlr4	UTSW	4	66929082	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AACTTAAGCAGTTTCCAACTCTGG -3'
(R):5'- TGTTGAGACTGGTCAAGCC -3'

Sequencing Primer
(F):5'- ACTCTGGATCTACCCTTTCTTAAAAG -3'
(R):5'- TGGTCAAGCCAAGAAATATACCATCG -3'

Posted On

2019-10-24