Incidental Mutation 'R7638:C77080'
ID590050
Institutional Source Beutler Lab
Gene Symbol C77080
Ensembl Gene ENSMUSG00000050390
Gene Nameexpressed sequence C77080
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R7638 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location129219578-129261404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129221941 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1022 (T1022A)
Ref Sequence ENSEMBL: ENSMUSP00000062395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052602] [ENSMUST00000097873] [ENSMUST00000106051] [ENSMUST00000106054] [ENSMUST00000145261] [ENSMUST00000146376]
Predicted Effect probably benign
Transcript: ENSMUST00000052602
AA Change: T1022A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062395
Gene: ENSMUSG00000050390
AA Change: T1022A

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 39 80 N/A INTRINSIC
low complexity region 209 215 N/A INTRINSIC
low complexity region 273 286 N/A INTRINSIC
low complexity region 365 382 N/A INTRINSIC
low complexity region 393 418 N/A INTRINSIC
low complexity region 449 464 N/A INTRINSIC
low complexity region 492 499 N/A INTRINSIC
low complexity region 532 550 N/A INTRINSIC
low complexity region 555 588 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 657 690 N/A INTRINSIC
low complexity region 724 739 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 810 833 N/A INTRINSIC
low complexity region 916 930 N/A INTRINSIC
low complexity region 988 1020 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097873
AA Change: T977A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095483
Gene: ENSMUSG00000050390
AA Change: T977A

DomainStartEndE-ValueType
low complexity region 164 170 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 348 373 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
low complexity region 447 454 N/A INTRINSIC
low complexity region 487 505 N/A INTRINSIC
low complexity region 510 543 N/A INTRINSIC
low complexity region 576 589 N/A INTRINSIC
low complexity region 612 645 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
low complexity region 698 728 N/A INTRINSIC
low complexity region 765 788 N/A INTRINSIC
low complexity region 871 885 N/A INTRINSIC
low complexity region 943 975 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106051
AA Change: T965A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101666
Gene: ENSMUSG00000050390
AA Change: T965A

DomainStartEndE-ValueType
low complexity region 152 158 N/A INTRINSIC
low complexity region 216 229 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 336 361 N/A INTRINSIC
low complexity region 392 407 N/A INTRINSIC
low complexity region 435 442 N/A INTRINSIC
low complexity region 475 493 N/A INTRINSIC
low complexity region 498 531 N/A INTRINSIC
low complexity region 564 577 N/A INTRINSIC
low complexity region 600 633 N/A INTRINSIC
low complexity region 667 682 N/A INTRINSIC
low complexity region 686 716 N/A INTRINSIC
low complexity region 753 776 N/A INTRINSIC
low complexity region 859 873 N/A INTRINSIC
low complexity region 931 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106054
SMART Domains Protein: ENSMUSP00000101669
Gene: ENSMUSG00000028811

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:tRNA-synt_1b 67 358 1e-78 PFAM
Pfam:tRNA_bind 406 502 7.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145261
Predicted Effect probably benign
Transcript: ENSMUST00000146376
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,320,917 V161A probably damaging Het
Abo T G 2: 26,843,843 T115P probably damaging Het
Aggf1 G A 13: 95,356,413 R563* probably null Het
Amdhd1 A T 10: 93,534,498 Y159* probably null Het
BC027072 T C 17: 71,750,885 D599G probably damaging Het
Camp T C 9: 109,848,393 E124G Het
Casq2 A G 3: 102,086,700 E21G possibly damaging Het
Cbln1 A T 8: 87,471,729 F116Y probably damaging Het
Cklf A T 8: 104,263,364 K143* probably null Het
Clca3a1 A G 3: 144,751,962 I387T probably damaging Het
Cndp1 T A 18: 84,636,049 D130V probably benign Het
Cyp4a12a T A 4: 115,327,473 M317K possibly damaging Het
D13Ertd608e A T 13: 119,842,688 probably null Het
Dmxl2 A T 9: 54,457,794 I138K unknown Het
Eapp A G 12: 54,673,723 S236P probably benign Het
Efnb3 T C 11: 69,557,220 H132R possibly damaging Het
Fbn2 A T 18: 58,105,136 N596K probably damaging Het
Fzd9 A G 5: 135,250,630 W134R probably damaging Het
Gga2 A G 7: 122,003,934 S180P probably damaging Het
Gm11639 T A 11: 105,036,799 M4798K probably benign Het
Gm30302 G T 13: 49,786,975 Q420K probably benign Het
Golga3 A G 5: 110,205,828 T911A probably benign Het
Gstm1 C T 3: 108,014,550 probably null Het
Heg1 A G 16: 33,727,497 T909A probably damaging Het
Herc2 T C 7: 56,157,438 S2455P probably benign Het
Herc2 C T 7: 56,220,525 R4349W probably damaging Het
Hivep2 T G 10: 14,143,851 M2122R possibly damaging Het
Itga10 T A 3: 96,657,391 probably null Het
Kbtbd13 G T 9: 65,391,323 C110* probably null Het
Krt78 T C 15: 101,950,883 E293G probably damaging Het
Lgals3bp C T 11: 118,398,169 V110M possibly damaging Het
Lrp2 A G 2: 69,477,008 probably null Het
Lrrc14 A G 15: 76,713,973 D301G probably benign Het
Lrrc71 C A 3: 87,741,806 G352W probably damaging Het
Map3k9 A G 12: 81,724,732 V694A probably benign Het
Mboat2 T C 12: 24,939,326 S162P probably damaging Het
Megf11 C A 9: 64,679,253 N422K probably damaging Het
Miga1 C T 3: 152,276,687 S584N probably benign Het
Mindy2 A G 9: 70,616,859 Y403H probably damaging Het
Mmd C T 11: 90,276,757 A204V possibly damaging Het
Mta3 A T 17: 83,800,143 Y262F probably benign Het
Ncoa7 G A 10: 30,722,798 S43F probably benign Het
Nphp4 T C 4: 152,554,534 V874A probably benign Het
Nsd1 A G 13: 55,312,328 T2226A probably benign Het
Nt5dc1 T C 10: 34,314,796 H302R probably benign Het
Odc1 A G 12: 17,550,002 Y389C probably damaging Het
Olfr175-ps1 G A 16: 58,824,595 T38I probably damaging Het
Olfr551 A G 7: 102,587,918 I275T probably damaging Het
Olfr970 T G 9: 39,819,893 F85V probably damaging Het
Pcdhb10 A C 18: 37,412,312 Q147P probably benign Het
Pdcl2 A C 5: 76,317,828 C182G probably damaging Het
Pigv T C 4: 133,665,451 D136G possibly damaging Het
Pramel5 T C 4: 144,271,440 E411G possibly damaging Het
Prkce T C 17: 86,168,600 V3A probably benign Het
Pth1r T C 9: 110,722,393 N546S probably benign Het
Qrich2 C T 11: 116,455,322 V1559I probably benign Het
Rbm20 A C 19: 53,814,333 D424A possibly damaging Het
Rbm26 C T 14: 105,150,848 D393N probably damaging Het
Sf3b3 G A 8: 110,820,813 R728C probably damaging Het
Srcap A G 7: 127,538,748 N1090S probably benign Het
Syt4 A T 18: 31,443,822 S160T probably benign Het
Tfap2e C T 4: 126,721,934 V236M probably damaging Het
Thsd4 G A 9: 60,394,472 T180M probably damaging Het
Tlr4 T A 4: 66,840,206 M412K probably damaging Het
Tmem67 T A 4: 12,079,883 H136L probably benign Het
Tnpo2 T A 8: 85,044,415 I110N probably benign Het
Trav13d-3 A G 14: 53,033,413 M111V probably benign Het
Tubb3 A T 8: 123,421,161 S278C probably benign Het
Ugcg T A 4: 59,220,299 F364Y probably benign Het
Usp17lc T C 7: 103,418,499 S334P probably damaging Het
Vps13c A G 9: 67,945,509 D2357G probably damaging Het
Zfp157 T C 5: 138,455,910 Y125H probably benign Het
Zfp747 A T 7: 127,374,647 M117K probably benign Het
Znrd1 A C 17: 36,957,830 probably null Het
Zscan4c A T 7: 11,009,731 N419I possibly damaging Het
Other mutations in C77080
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:C77080 APN 4 129222796 splice site probably null
IGL02654:C77080 APN 4 129222319 missense probably damaging 1.00
IGL02797:C77080 APN 4 129223311 missense probably damaging 0.99
IGL03231:C77080 APN 4 129223681 missense possibly damaging 0.73
IGL03134:C77080 UTSW 4 129222487 missense possibly damaging 0.53
R0078:C77080 UTSW 4 129227723 splice site probably null
R0418:C77080 UTSW 4 129223684 missense probably damaging 1.00
R1374:C77080 UTSW 4 129222289 missense possibly damaging 0.83
R1632:C77080 UTSW 4 129222666 missense possibly damaging 0.94
R1735:C77080 UTSW 4 129223577 missense probably damaging 1.00
R1970:C77080 UTSW 4 129226017 splice site probably benign
R2018:C77080 UTSW 4 129222355 missense probably damaging 0.96
R2157:C77080 UTSW 4 129224124 missense possibly damaging 0.76
R2201:C77080 UTSW 4 129222639 missense probably benign
R2316:C77080 UTSW 4 129223747 missense probably damaging 1.00
R3751:C77080 UTSW 4 129224322 unclassified probably benign
R4648:C77080 UTSW 4 129221940 missense probably benign 0.00
R4790:C77080 UTSW 4 129223302 missense probably damaging 1.00
R4885:C77080 UTSW 4 129224445 missense probably damaging 1.00
R5217:C77080 UTSW 4 129222685 missense probably damaging 0.99
R5270:C77080 UTSW 4 129224212 missense possibly damaging 0.48
R5272:C77080 UTSW 4 129224212 missense possibly damaging 0.48
R5273:C77080 UTSW 4 129224212 missense possibly damaging 0.48
R5314:C77080 UTSW 4 129224212 missense possibly damaging 0.48
R5548:C77080 UTSW 4 129223980 frame shift probably null
R5752:C77080 UTSW 4 129223980 frame shift probably null
R5908:C77080 UTSW 4 129222148 missense probably damaging 0.98
R5960:C77080 UTSW 4 129222072 missense probably damaging 0.99
R7024:C77080 UTSW 4 129225408 missense probably null 0.73
R7296:C77080 UTSW 4 129225418 missense probably damaging 1.00
R7447:C77080 UTSW 4 129222042 missense possibly damaging 0.63
R7689:C77080 UTSW 4 129223773 missense probably benign 0.25
R7819:C77080 UTSW 4 129222483 missense probably benign 0.31
R8213:C77080 UTSW 4 129221459 missense possibly damaging 0.64
R8219:C77080 UTSW 4 129248153 missense possibly damaging 0.55
R8360:C77080 UTSW 4 129224202 missense possibly damaging 0.89
Z1088:C77080 UTSW 4 129222298 missense probably damaging 1.00
Z1176:C77080 UTSW 4 129223704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGCATGCCCACCTATGG -3'
(R):5'- AGCTTCATCTTCTCCAAGGGC -3'

Sequencing Primer
(F):5'- TATGGTGGGCCCTCTGAGAAC -3'
(R):5'- AACTGCAGCTGGAGAGGCC -3'
Posted On2019-10-24