Incidental Mutation 'R7638:Golga3'
ID590055
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Namegolgi autoantigen, golgin subfamily a, 3
Synonymsrepro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7638 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location110176701-110226470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110205828 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 911 (T911A)
Ref Sequence ENSEMBL: ENSMUSP00000108131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]
Predicted Effect probably benign
Transcript: ENSMUST00000031477
AA Change: T951A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: T951A

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112512
AA Change: T911A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: T911A

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,320,917 V161A probably damaging Het
Abo T G 2: 26,843,843 T115P probably damaging Het
Aggf1 G A 13: 95,356,413 R563* probably null Het
Amdhd1 A T 10: 93,534,498 Y159* probably null Het
BC027072 T C 17: 71,750,885 D599G probably damaging Het
C77080 T C 4: 129,221,941 T1022A probably benign Het
Camp T C 9: 109,848,393 E124G Het
Casq2 A G 3: 102,086,700 E21G possibly damaging Het
Cbln1 A T 8: 87,471,729 F116Y probably damaging Het
Cklf A T 8: 104,263,364 K143* probably null Het
Clca3a1 A G 3: 144,751,962 I387T probably damaging Het
Cndp1 T A 18: 84,636,049 D130V probably benign Het
Cyp4a12a T A 4: 115,327,473 M317K possibly damaging Het
D13Ertd608e A T 13: 119,842,688 probably null Het
Dmxl2 A T 9: 54,457,794 I138K unknown Het
Eapp A G 12: 54,673,723 S236P probably benign Het
Efnb3 T C 11: 69,557,220 H132R possibly damaging Het
Fbn2 A T 18: 58,105,136 N596K probably damaging Het
Fzd9 A G 5: 135,250,630 W134R probably damaging Het
Gga2 A G 7: 122,003,934 S180P probably damaging Het
Gm11639 T A 11: 105,036,799 M4798K probably benign Het
Gm30302 G T 13: 49,786,975 Q420K probably benign Het
Gstm1 C T 3: 108,014,550 probably null Het
Heg1 A G 16: 33,727,497 T909A probably damaging Het
Herc2 T C 7: 56,157,438 S2455P probably benign Het
Herc2 C T 7: 56,220,525 R4349W probably damaging Het
Hivep2 T G 10: 14,143,851 M2122R possibly damaging Het
Itga10 T A 3: 96,657,391 probably null Het
Kbtbd13 G T 9: 65,391,323 C110* probably null Het
Krt78 T C 15: 101,950,883 E293G probably damaging Het
Lgals3bp C T 11: 118,398,169 V110M possibly damaging Het
Lrp2 A G 2: 69,477,008 probably null Het
Lrrc14 A G 15: 76,713,973 D301G probably benign Het
Lrrc71 C A 3: 87,741,806 G352W probably damaging Het
Map3k9 A G 12: 81,724,732 V694A probably benign Het
Mboat2 T C 12: 24,939,326 S162P probably damaging Het
Megf11 C A 9: 64,679,253 N422K probably damaging Het
Miga1 C T 3: 152,276,687 S584N probably benign Het
Mindy2 A G 9: 70,616,859 Y403H probably damaging Het
Mmd C T 11: 90,276,757 A204V possibly damaging Het
Mta3 A T 17: 83,800,143 Y262F probably benign Het
Ncoa7 G A 10: 30,722,798 S43F probably benign Het
Nphp4 T C 4: 152,554,534 V874A probably benign Het
Nsd1 A G 13: 55,312,328 T2226A probably benign Het
Nt5dc1 T C 10: 34,314,796 H302R probably benign Het
Odc1 A G 12: 17,550,002 Y389C probably damaging Het
Olfr175-ps1 G A 16: 58,824,595 T38I probably damaging Het
Olfr551 A G 7: 102,587,918 I275T probably damaging Het
Olfr970 T G 9: 39,819,893 F85V probably damaging Het
Pcdhb10 A C 18: 37,412,312 Q147P probably benign Het
Pdcl2 A C 5: 76,317,828 C182G probably damaging Het
Pigv T C 4: 133,665,451 D136G possibly damaging Het
Pramel5 T C 4: 144,271,440 E411G possibly damaging Het
Prkce T C 17: 86,168,600 V3A probably benign Het
Pth1r T C 9: 110,722,393 N546S probably benign Het
Qrich2 C T 11: 116,455,322 V1559I probably benign Het
Rbm20 A C 19: 53,814,333 D424A possibly damaging Het
Rbm26 C T 14: 105,150,848 D393N probably damaging Het
Sf3b3 G A 8: 110,820,813 R728C probably damaging Het
Srcap A G 7: 127,538,748 N1090S probably benign Het
Syt4 A T 18: 31,443,822 S160T probably benign Het
Tfap2e C T 4: 126,721,934 V236M probably damaging Het
Thsd4 G A 9: 60,394,472 T180M probably damaging Het
Tlr4 T A 4: 66,840,206 M412K probably damaging Het
Tmem67 T A 4: 12,079,883 H136L probably benign Het
Tnpo2 T A 8: 85,044,415 I110N probably benign Het
Trav13d-3 A G 14: 53,033,413 M111V probably benign Het
Tubb3 A T 8: 123,421,161 S278C probably benign Het
Ugcg T A 4: 59,220,299 F364Y probably benign Het
Usp17lc T C 7: 103,418,499 S334P probably damaging Het
Vps13c A G 9: 67,945,509 D2357G probably damaging Het
Zfp157 T C 5: 138,455,910 Y125H probably benign Het
Zfp747 A T 7: 127,374,647 M117K probably benign Het
Znrd1 A C 17: 36,957,830 probably null Het
Zscan4c A T 7: 11,009,731 N419I possibly damaging Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110220887 missense probably damaging 1.00
IGL00594:Golga3 APN 5 110204975 missense probably benign 0.37
IGL00672:Golga3 APN 5 110212244 missense probably damaging 1.00
IGL00821:Golga3 APN 5 110204933 missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110187717 missense probably benign 0.04
IGL01408:Golga3 APN 5 110217809 critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110192905 critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110188746 missense probably benign 0.26
tenta UTSW 5 110218130 nonsense probably null
PIT4544001:Golga3 UTSW 5 110188690 missense possibly damaging 0.94
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110188743 missense probably damaging 1.00
R1219:Golga3 UTSW 5 110184349 nonsense probably null
R1297:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1299:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1589:Golga3 UTSW 5 110181783 missense probably damaging 1.00
R1795:Golga3 UTSW 5 110207627 missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110192973 missense probably damaging 0.96
R2116:Golga3 UTSW 5 110187395 missense probably damaging 0.97
R2130:Golga3 UTSW 5 110202939 critical splice donor site probably null
R2153:Golga3 UTSW 5 110187990 splice site probably null
R2158:Golga3 UTSW 5 110187361 missense probably damaging 1.00
R2357:Golga3 UTSW 5 110202648 missense probably damaging 1.00
R2397:Golga3 UTSW 5 110205877 splice site probably benign
R2418:Golga3 UTSW 5 110201868 missense probably damaging 1.00
R2495:Golga3 UTSW 5 110207596 missense probably damaging 0.99
R2763:Golga3 UTSW 5 110204895 missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110201998 splice site probably benign
R3614:Golga3 UTSW 5 110220908 missense probably damaging 1.00
R4520:Golga3 UTSW 5 110203751 nonsense probably null
R5001:Golga3 UTSW 5 110205777 missense probably damaging 1.00
R5046:Golga3 UTSW 5 110192940 missense probably damaging 0.99
R5157:Golga3 UTSW 5 110202671 missense probably benign 0.00
R5191:Golga3 UTSW 5 110184307 intron probably benign
R5376:Golga3 UTSW 5 110220945 critical splice donor site probably null
R5399:Golga3 UTSW 5 110205024 missense probably damaging 0.96
R5407:Golga3 UTSW 5 110201990 nonsense probably null
R5884:Golga3 UTSW 5 110216895 missense probably damaging 1.00
R6087:Golga3 UTSW 5 110204946 missense probably damaging 0.99
R6526:Golga3 UTSW 5 110204895 missense probably damaging 0.98
R6651:Golga3 UTSW 5 110218130 nonsense probably null
R7041:Golga3 UTSW 5 110208584 critical splice donor site probably null
R7057:Golga3 UTSW 5 110188663 missense probably damaging 1.00
R7078:Golga3 UTSW 5 110193087 missense probably damaging 0.99
R7114:Golga3 UTSW 5 110202712 missense probably benign 0.01
R7190:Golga3 UTSW 5 110209855 missense probably damaging 1.00
R7405:Golga3 UTSW 5 110208446 missense probably damaging 0.97
R7528:Golga3 UTSW 5 110212232 missense probably damaging 1.00
R7760:Golga3 UTSW 5 110205850 missense probably benign 0.39
R8099:Golga3 UTSW 5 110188707 nonsense probably null
R8144:Golga3 UTSW 5 110185879 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGCCTGGAAATAGTGGTC -3'
(R):5'- TTAGAACCATGCTCCAGGC -3'

Sequencing Primer
(F):5'- TTGAGTCCTCTAAGAGAGCAGCC -3'
(R):5'- CTCCAGGCTGCTCAAGTTTAAAAAGG -3'
Posted On2019-10-24