Incidental Mutation 'R7638:Fzd9'
ID590056
Institutional Source Beutler Lab
Gene Symbol Fzd9
Ensembl Gene ENSMUSG00000049551
Gene Namefrizzled class receptor 9
Synonymsmfz9, frizzled 9
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R7638 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location135248938-135251230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135250630 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 134 (W134R)
Ref Sequence ENSEMBL: ENSMUSP00000053551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002825] [ENSMUST00000062572]
Predicted Effect probably benign
Transcript: ENSMUST00000002825
SMART Domains Protein: ENSMUSP00000002825
Gene: ENSMUSG00000002748

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 21 120 2.6e-28 PFAM
low complexity region 312 335 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
coiled coil region 537 587 N/A INTRINSIC
DDT 605 669 5.59e-17 SMART
Pfam:WHIM1 725 773 2.2e-9 PFAM
low complexity region 822 835 N/A INTRINSIC
coiled coil region 854 890 N/A INTRINSIC
Pfam:WHIM2 900 935 1.3e-10 PFAM
Pfam:WHIM3 991 1029 1.5e-16 PFAM
low complexity region 1131 1148 N/A INTRINSIC
PHD 1186 1232 1.89e-14 SMART
RING 1187 1231 7.85e-2 SMART
low complexity region 1245 1277 N/A INTRINSIC
BROMO 1333 1441 3.63e-37 SMART
low complexity region 1459 1472 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000062572
AA Change: W134R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053551
Gene: ENSMUSG00000049551
AA Change: W134R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FRI 39 158 1.97e-73 SMART
low complexity region 177 195 N/A INTRINSIC
Frizzled 222 548 4.64e-199 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD9 gene is located within the Williams syndrome common deletion region of chromosome 7, and heterozygous deletion of the FZD9 gene may contribute to the Williams syndrome phenotype. FZD9 is expressed predominantly in brain, testis, eye, skeletal muscle, and kidney. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one allele exhibit immune system abnormalities while another null allele causes neurological abnormalities. A third null mutation results in growth retardation and abnormalities in bone mineralization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,320,917 V161A probably damaging Het
Abo T G 2: 26,843,843 T115P probably damaging Het
Aggf1 G A 13: 95,356,413 R563* probably null Het
Amdhd1 A T 10: 93,534,498 Y159* probably null Het
BC027072 T C 17: 71,750,885 D599G probably damaging Het
C77080 T C 4: 129,221,941 T1022A probably benign Het
Camp T C 9: 109,848,393 E124G Het
Casq2 A G 3: 102,086,700 E21G possibly damaging Het
Cbln1 A T 8: 87,471,729 F116Y probably damaging Het
Cklf A T 8: 104,263,364 K143* probably null Het
Clca3a1 A G 3: 144,751,962 I387T probably damaging Het
Cndp1 T A 18: 84,636,049 D130V probably benign Het
Cyp4a12a T A 4: 115,327,473 M317K possibly damaging Het
D13Ertd608e A T 13: 119,842,688 probably null Het
Dmxl2 A T 9: 54,457,794 I138K unknown Het
Eapp A G 12: 54,673,723 S236P probably benign Het
Efnb3 T C 11: 69,557,220 H132R possibly damaging Het
Fbn2 A T 18: 58,105,136 N596K probably damaging Het
Gga2 A G 7: 122,003,934 S180P probably damaging Het
Gm11639 T A 11: 105,036,799 M4798K probably benign Het
Gm30302 G T 13: 49,786,975 Q420K probably benign Het
Golga3 A G 5: 110,205,828 T911A probably benign Het
Gstm1 C T 3: 108,014,550 probably null Het
Heg1 A G 16: 33,727,497 T909A probably damaging Het
Herc2 T C 7: 56,157,438 S2455P probably benign Het
Herc2 C T 7: 56,220,525 R4349W probably damaging Het
Hivep2 T G 10: 14,143,851 M2122R possibly damaging Het
Itga10 T A 3: 96,657,391 probably null Het
Kbtbd13 G T 9: 65,391,323 C110* probably null Het
Krt78 T C 15: 101,950,883 E293G probably damaging Het
Lgals3bp C T 11: 118,398,169 V110M possibly damaging Het
Lrp2 A G 2: 69,477,008 probably null Het
Lrrc14 A G 15: 76,713,973 D301G probably benign Het
Lrrc71 C A 3: 87,741,806 G352W probably damaging Het
Map3k9 A G 12: 81,724,732 V694A probably benign Het
Mboat2 T C 12: 24,939,326 S162P probably damaging Het
Megf11 C A 9: 64,679,253 N422K probably damaging Het
Miga1 C T 3: 152,276,687 S584N probably benign Het
Mindy2 A G 9: 70,616,859 Y403H probably damaging Het
Mmd C T 11: 90,276,757 A204V possibly damaging Het
Mta3 A T 17: 83,800,143 Y262F probably benign Het
Ncoa7 G A 10: 30,722,798 S43F probably benign Het
Nphp4 T C 4: 152,554,534 V874A probably benign Het
Nsd1 A G 13: 55,312,328 T2226A probably benign Het
Nt5dc1 T C 10: 34,314,796 H302R probably benign Het
Odc1 A G 12: 17,550,002 Y389C probably damaging Het
Olfr175-ps1 G A 16: 58,824,595 T38I probably damaging Het
Olfr551 A G 7: 102,587,918 I275T probably damaging Het
Olfr970 T G 9: 39,819,893 F85V probably damaging Het
Pcdhb10 A C 18: 37,412,312 Q147P probably benign Het
Pdcl2 A C 5: 76,317,828 C182G probably damaging Het
Pigv T C 4: 133,665,451 D136G possibly damaging Het
Pramel5 T C 4: 144,271,440 E411G possibly damaging Het
Prkce T C 17: 86,168,600 V3A probably benign Het
Pth1r T C 9: 110,722,393 N546S probably benign Het
Qrich2 C T 11: 116,455,322 V1559I probably benign Het
Rbm20 A C 19: 53,814,333 D424A possibly damaging Het
Rbm26 C T 14: 105,150,848 D393N probably damaging Het
Sf3b3 G A 8: 110,820,813 R728C probably damaging Het
Srcap A G 7: 127,538,748 N1090S probably benign Het
Syt4 A T 18: 31,443,822 S160T probably benign Het
Tfap2e C T 4: 126,721,934 V236M probably damaging Het
Thsd4 G A 9: 60,394,472 T180M probably damaging Het
Tlr4 T A 4: 66,840,206 M412K probably damaging Het
Tmem67 T A 4: 12,079,883 H136L probably benign Het
Tnpo2 T A 8: 85,044,415 I110N probably benign Het
Trav13d-3 A G 14: 53,033,413 M111V probably benign Het
Tubb3 A T 8: 123,421,161 S278C probably benign Het
Ugcg T A 4: 59,220,299 F364Y probably benign Het
Usp17lc T C 7: 103,418,499 S334P probably damaging Het
Vps13c A G 9: 67,945,509 D2357G probably damaging Het
Zfp157 T C 5: 138,455,910 Y125H probably benign Het
Zfp747 A T 7: 127,374,647 M117K probably benign Het
Znrd1 A C 17: 36,957,830 probably null Het
Zscan4c A T 7: 11,009,731 N419I possibly damaging Het
Other mutations in Fzd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Fzd9 APN 5 135249469 missense probably damaging 1.00
IGL01446:Fzd9 APN 5 135250566 missense probably damaging 1.00
IGL02510:Fzd9 APN 5 135249615 missense probably damaging 1.00
R0308:Fzd9 UTSW 5 135249406 missense probably damaging 0.97
R0417:Fzd9 UTSW 5 135249619 missense probably damaging 0.99
R1563:Fzd9 UTSW 5 135250554 missense probably damaging 0.96
R1638:Fzd9 UTSW 5 135249748 missense probably damaging 1.00
R1840:Fzd9 UTSW 5 135249571 missense probably benign
R2046:Fzd9 UTSW 5 135249684 missense probably damaging 1.00
R2268:Fzd9 UTSW 5 135250294 missense probably damaging 1.00
R2898:Fzd9 UTSW 5 135249846 missense probably damaging 1.00
R4078:Fzd9 UTSW 5 135249636 missense probably benign 0.01
R4079:Fzd9 UTSW 5 135249636 missense probably benign 0.01
R4576:Fzd9 UTSW 5 135250312 missense probably damaging 1.00
R4662:Fzd9 UTSW 5 135249621 missense probably damaging 1.00
R4956:Fzd9 UTSW 5 135249942 missense probably damaging 1.00
R5096:Fzd9 UTSW 5 135249859 missense probably damaging 0.96
R5227:Fzd9 UTSW 5 135249606 missense probably benign 0.06
R5452:Fzd9 UTSW 5 135250860 missense probably damaging 1.00
R5475:Fzd9 UTSW 5 135250269 splice site probably null
R5888:Fzd9 UTSW 5 135249463 splice site probably null
R5914:Fzd9 UTSW 5 135249345 missense probably benign
R7148:Fzd9 UTSW 5 135249690 missense probably benign 0.40
R7544:Fzd9 UTSW 5 135249862 missense probably damaging 1.00
X0063:Fzd9 UTSW 5 135249721 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACTGGAACTTCTCGGGGTTG -3'
(R):5'- ATTGGCTACAACCTGACCCG -3'

Sequencing Primer
(F):5'- AACTTCTCGGGGTTGTCGCAG -3'
(R):5'- GCATGCCCAACCTACTGG -3'
Posted On2019-10-24