Mutagenetix > Incidental Mutation

Incidental Mutation 'R7638:Gga2'

590063

Institutional Source

Beutler Lab

Gene Symbol

Gga2

Ensembl Gene

ENSMUSG00000030872

Gene Name

golgi associated, gamma adaptin ear containing, ARF binding protein 2

Synonyms

MMRRC Submission

045696-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7638 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121986722-122021222 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122003934 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 180 (S180P)

Ref Sequence

ENSEMBL: ENSMUSP00000033160 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033160] [ENSMUST00000124566]

AlphaFold

Q6P5E6

Predicted Effect

probably damaging
Transcript: ENSMUST00000033160
AA Change: S180P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000033160
Gene: ENSMUSG00000030872
AA Change: S180P

Domain	Start	End	E-Value	Type
low complexity region	13	28	N/A	INTRINSIC
VHS	29	162	2.45e-58	SMART
Pfam:GAT	241	318	2.2e-20	PFAM
low complexity region	320	338	N/A	INTRINSIC
Alpha_adaptinC2	471	595	8.68e-39	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000124566
AA Change: S180P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115581
Gene: ENSMUSG00000030872
AA Change: S180P

Domain	Start	End	E-Value	Type
low complexity region	13	28	N/A	INTRINSIC
VHS	29	162	2.45e-58	SMART
Pfam:GAT	225	326	1.3e-30	PFAM
Alpha_adaptinC2	471	595	8.68e-39	SMART

Meta Mutation Damage Score

0.0620

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) family. This family includes ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. This family member may play a significant role in cargo molecules regulation and clathrin-coated vesicle assembly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality. Mice homozygous for a different gene trapped allele show decreased birth weight, hypoglycemia and partial neonatal lethality, with all remaining mice dying within the first three weeks of life. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563D23Rik	A	G	16: 92,320,917	V161A	probably damaging	Het
Abo	T	G	2: 26,843,843	T115P	probably damaging	Het
Aggf1	G	A	13: 95,356,413	R563*	probably null	Het
Amdhd1	A	T	10: 93,534,498	Y159*	probably null	Het
BC027072	T	C	17: 71,750,885	D599G	probably damaging	Het
C77080	T	C	4: 129,221,941	T1022A	probably benign	Het
Camp	T	C	9: 109,848,393	E124G		Het
Casq2	A	G	3: 102,086,700	E21G	possibly damaging	Het
Cbln1	A	T	8: 87,471,729	F116Y	probably damaging	Het
Cklf	A	T	8: 104,263,364	K143*	probably null	Het
Clca3a1	A	G	3: 144,751,962	I387T	probably damaging	Het
Cndp1	T	A	18: 84,636,049	D130V	probably benign	Het
Cyp4a12a	T	A	4: 115,327,473	M317K	possibly damaging	Het
D13Ertd608e	A	T	13: 119,842,688		probably null	Het
Dmxl2	A	T	9: 54,457,794	I138K	unknown	Het
Eapp	A	G	12: 54,673,723	S236P	probably benign	Het
Efnb3	T	C	11: 69,557,220	H132R	possibly damaging	Het
Fbn2	A	T	18: 58,105,136	N596K	probably damaging	Het
Fzd9	A	G	5: 135,250,630	W134R	probably damaging	Het
Gm11639	T	A	11: 105,036,799	M4798K	probably benign	Het
Gm30302	G	T	13: 49,786,975	Q420K	probably benign	Het
Golga3	A	G	5: 110,205,828	T911A	probably benign	Het
Gstm1	C	T	3: 108,014,550		probably null	Het
Heg1	A	G	16: 33,727,497	T909A	probably damaging	Het
Herc2	T	C	7: 56,157,438	S2455P	probably benign	Het
Herc2	C	T	7: 56,220,525	R4349W	probably damaging	Het
Hivep2	T	G	10: 14,143,851	M2122R	possibly damaging	Het
Itga10	T	A	3: 96,657,391		probably null	Het
Kbtbd13	G	T	9: 65,391,323	C110*	probably null	Het
Krt78	T	C	15: 101,950,883	E293G	probably damaging	Het
Lgals3bp	C	T	11: 118,398,169	V110M	possibly damaging	Het
Lrp2	A	G	2: 69,477,008		probably null	Het
Lrrc14	A	G	15: 76,713,973	D301G	probably benign	Het
Lrrc71	C	A	3: 87,741,806	G352W	probably damaging	Het
Map3k9	A	G	12: 81,724,732	V694A	probably benign	Het
Mboat2	T	C	12: 24,939,326	S162P	probably damaging	Het
Megf11	C	A	9: 64,679,253	N422K	probably damaging	Het
Miga1	C	T	3: 152,276,687	S584N	probably benign	Het
Mindy2	A	G	9: 70,616,859	Y403H	probably damaging	Het
Mmd	C	T	11: 90,276,757	A204V	possibly damaging	Het
Mta3	A	T	17: 83,800,143	Y262F	probably benign	Het
Ncoa7	G	A	10: 30,722,798	S43F	probably benign	Het
Nphp4	T	C	4: 152,554,534	V874A	probably benign	Het
Nsd1	A	G	13: 55,312,328	T2226A	probably benign	Het
Nt5dc1	T	C	10: 34,314,796	H302R	probably benign	Het
Odc1	A	G	12: 17,550,002	Y389C	probably damaging	Het
Olfr175-ps1	G	A	16: 58,824,595	T38I	probably damaging	Het
Olfr551	A	G	7: 102,587,918	I275T	probably damaging	Het
Olfr970	T	G	9: 39,819,893	F85V	probably damaging	Het
Pcdhb10	A	C	18: 37,412,312	Q147P	probably benign	Het
Pdcl2	A	C	5: 76,317,828	C182G	probably damaging	Het
Pigv	T	C	4: 133,665,451	D136G	possibly damaging	Het
Pramel5	T	C	4: 144,271,440	E411G	possibly damaging	Het
Prkce	T	C	17: 86,168,600	V3A	probably benign	Het
Pth1r	T	C	9: 110,722,393	N546S	probably benign	Het
Qrich2	C	T	11: 116,455,322	V1559I	probably benign	Het
Rbm20	A	C	19: 53,814,333	D424A	possibly damaging	Het
Rbm26	C	T	14: 105,150,848	D393N	probably damaging	Het
Sf3b3	G	A	8: 110,820,813	R728C	probably damaging	Het
Srcap	A	G	7: 127,538,748	N1090S	probably benign	Het
Syt4	A	T	18: 31,443,822	S160T	probably benign	Het
Tfap2e	C	T	4: 126,721,934	V236M	probably damaging	Het
Thsd4	G	A	9: 60,394,472	T180M	probably damaging	Het
Tlr4	T	A	4: 66,840,206	M412K	probably damaging	Het
Tmem67	T	A	4: 12,079,883	H136L	probably benign	Het
Tnpo2	T	A	8: 85,044,415	I110N	probably benign	Het
Trav13d-3	A	G	14: 53,033,413	M111V	probably benign	Het
Tubb3	A	T	8: 123,421,161	S278C	probably benign	Het
Ugcg	T	A	4: 59,220,299	F364Y	probably benign	Het
Usp17lc	T	C	7: 103,418,499	S334P	probably damaging	Het
Vps13c	A	G	9: 67,945,509	D2357G	probably damaging	Het
Zfp157	T	C	5: 138,455,910	Y125H	probably benign	Het
Zfp747	A	T	7: 127,374,647	M117K	probably benign	Het
Znrd1	A	C	17: 36,957,830		probably null	Het
Zscan4c	A	T	7: 11,009,731	N419I	possibly damaging	Het

Other mutations in Gga2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01519:Gga2	APN	7	122002188	missense	probably damaging	1.00
IGL01577:Gga2	APN	7	121989783	missense	probably damaging	1.00
IGL01584:Gga2	APN	7	121991538	missense	probably benign
IGL01671:Gga2	APN	7	121994856	missense	probably benign	0.01
IGL01680:Gga2	APN	7	121998076	missense	probably benign	0.06
IGL02745:Gga2	APN	7	122008369	missense	probably damaging	1.00
R0122:Gga2	UTSW	7	121991574	missense	probably damaging	1.00
R0218:Gga2	UTSW	7	121998900	missense	possibly damaging	0.46
R1367:Gga2	UTSW	7	121998915	nonsense	probably null
R1774:Gga2	UTSW	7	122012221	missense	probably damaging	0.98
R4127:Gga2	UTSW	7	122002720	missense	probably damaging	1.00
R4510:Gga2	UTSW	7	122021078	missense	unknown
R6319:Gga2	UTSW	7	122002166	missense	possibly damaging	0.92
R6395:Gga2	UTSW	7	122008438	splice site	probably null
R6486:Gga2	UTSW	7	122002188	missense	probably damaging	1.00
R6952:Gga2	UTSW	7	121998888	missense	probably benign	0.00
R7035:Gga2	UTSW	7	121989716	missense	probably damaging	1.00
R7320:Gga2	UTSW	7	122002103	missense	probably benign
R7454:Gga2	UTSW	7	122002146	missense	probably benign	0.00
R7593:Gga2	UTSW	7	121990449	missense	probably benign	0.00
R7602:Gga2	UTSW	7	121997330	missense	probably benign	0.05
R7736:Gga2	UTSW	7	121990524	missense	probably damaging	1.00
R8032:Gga2	UTSW	7	122020987	critical splice donor site	probably null
R8803:Gga2	UTSW	7	121997779	missense	probably benign	0.01
R8817:Gga2	UTSW	7	121991622	nonsense	probably null
R9420:Gga2	UTSW	7	122003972	missense	probably damaging	1.00
R9515:Gga2	UTSW	7	122012225	missense	probably damaging	1.00
R9660:Gga2	UTSW	7	122007271	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TATACGGAACCAGATCCACCGG -3'
(R):5'- TGAGTAGATATACCTCTCTCCCATG -3'

Sequencing Primer
(F):5'- TACAGATAAAGGATGGTGCCC -3'
(R):5'- AGCCAGAGCTAATGATGG -3'

Posted On

2019-10-24