Incidental Mutation 'R7638:Gga2'
ID 590063
Institutional Source Beutler Lab
Gene Symbol Gga2
Ensembl Gene ENSMUSG00000030872
Gene Name golgi associated, gamma adaptin ear containing, ARF binding protein 2
Synonyms
MMRRC Submission 045696-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7638 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 121986722-122021222 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 122003934 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 180 (S180P)
Ref Sequence ENSEMBL: ENSMUSP00000033160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033160] [ENSMUST00000124566]
AlphaFold Q6P5E6
Predicted Effect probably damaging
Transcript: ENSMUST00000033160
AA Change: S180P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033160
Gene: ENSMUSG00000030872
AA Change: S180P

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
VHS 29 162 2.45e-58 SMART
Pfam:GAT 241 318 2.2e-20 PFAM
low complexity region 320 338 N/A INTRINSIC
Alpha_adaptinC2 471 595 8.68e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124566
AA Change: S180P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115581
Gene: ENSMUSG00000030872
AA Change: S180P

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
VHS 29 162 2.45e-58 SMART
Pfam:GAT 225 326 1.3e-30 PFAM
Alpha_adaptinC2 471 595 8.68e-39 SMART
Meta Mutation Damage Score 0.0620 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) family. This family includes ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. This family member may play a significant role in cargo molecules regulation and clathrin-coated vesicle assembly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality. Mice homozygous for a different gene trapped allele show decreased birth weight, hypoglycemia and partial neonatal lethality, with all remaining mice dying within the first three weeks of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,320,917 V161A probably damaging Het
Abo T G 2: 26,843,843 T115P probably damaging Het
Aggf1 G A 13: 95,356,413 R563* probably null Het
Amdhd1 A T 10: 93,534,498 Y159* probably null Het
BC027072 T C 17: 71,750,885 D599G probably damaging Het
C77080 T C 4: 129,221,941 T1022A probably benign Het
Camp T C 9: 109,848,393 E124G Het
Casq2 A G 3: 102,086,700 E21G possibly damaging Het
Cbln1 A T 8: 87,471,729 F116Y probably damaging Het
Cklf A T 8: 104,263,364 K143* probably null Het
Clca3a1 A G 3: 144,751,962 I387T probably damaging Het
Cndp1 T A 18: 84,636,049 D130V probably benign Het
Cyp4a12a T A 4: 115,327,473 M317K possibly damaging Het
D13Ertd608e A T 13: 119,842,688 probably null Het
Dmxl2 A T 9: 54,457,794 I138K unknown Het
Eapp A G 12: 54,673,723 S236P probably benign Het
Efnb3 T C 11: 69,557,220 H132R possibly damaging Het
Fbn2 A T 18: 58,105,136 N596K probably damaging Het
Fzd9 A G 5: 135,250,630 W134R probably damaging Het
Gm11639 T A 11: 105,036,799 M4798K probably benign Het
Gm30302 G T 13: 49,786,975 Q420K probably benign Het
Golga3 A G 5: 110,205,828 T911A probably benign Het
Gstm1 C T 3: 108,014,550 probably null Het
Heg1 A G 16: 33,727,497 T909A probably damaging Het
Herc2 T C 7: 56,157,438 S2455P probably benign Het
Herc2 C T 7: 56,220,525 R4349W probably damaging Het
Hivep2 T G 10: 14,143,851 M2122R possibly damaging Het
Itga10 T A 3: 96,657,391 probably null Het
Kbtbd13 G T 9: 65,391,323 C110* probably null Het
Krt78 T C 15: 101,950,883 E293G probably damaging Het
Lgals3bp C T 11: 118,398,169 V110M possibly damaging Het
Lrp2 A G 2: 69,477,008 probably null Het
Lrrc14 A G 15: 76,713,973 D301G probably benign Het
Lrrc71 C A 3: 87,741,806 G352W probably damaging Het
Map3k9 A G 12: 81,724,732 V694A probably benign Het
Mboat2 T C 12: 24,939,326 S162P probably damaging Het
Megf11 C A 9: 64,679,253 N422K probably damaging Het
Miga1 C T 3: 152,276,687 S584N probably benign Het
Mindy2 A G 9: 70,616,859 Y403H probably damaging Het
Mmd C T 11: 90,276,757 A204V possibly damaging Het
Mta3 A T 17: 83,800,143 Y262F probably benign Het
Ncoa7 G A 10: 30,722,798 S43F probably benign Het
Nphp4 T C 4: 152,554,534 V874A probably benign Het
Nsd1 A G 13: 55,312,328 T2226A probably benign Het
Nt5dc1 T C 10: 34,314,796 H302R probably benign Het
Odc1 A G 12: 17,550,002 Y389C probably damaging Het
Olfr175-ps1 G A 16: 58,824,595 T38I probably damaging Het
Olfr551 A G 7: 102,587,918 I275T probably damaging Het
Olfr970 T G 9: 39,819,893 F85V probably damaging Het
Pcdhb10 A C 18: 37,412,312 Q147P probably benign Het
Pdcl2 A C 5: 76,317,828 C182G probably damaging Het
Pigv T C 4: 133,665,451 D136G possibly damaging Het
Pramel5 T C 4: 144,271,440 E411G possibly damaging Het
Prkce T C 17: 86,168,600 V3A probably benign Het
Pth1r T C 9: 110,722,393 N546S probably benign Het
Qrich2 C T 11: 116,455,322 V1559I probably benign Het
Rbm20 A C 19: 53,814,333 D424A possibly damaging Het
Rbm26 C T 14: 105,150,848 D393N probably damaging Het
Sf3b3 G A 8: 110,820,813 R728C probably damaging Het
Srcap A G 7: 127,538,748 N1090S probably benign Het
Syt4 A T 18: 31,443,822 S160T probably benign Het
Tfap2e C T 4: 126,721,934 V236M probably damaging Het
Thsd4 G A 9: 60,394,472 T180M probably damaging Het
Tlr4 T A 4: 66,840,206 M412K probably damaging Het
Tmem67 T A 4: 12,079,883 H136L probably benign Het
Tnpo2 T A 8: 85,044,415 I110N probably benign Het
Trav13d-3 A G 14: 53,033,413 M111V probably benign Het
Tubb3 A T 8: 123,421,161 S278C probably benign Het
Ugcg T A 4: 59,220,299 F364Y probably benign Het
Usp17lc T C 7: 103,418,499 S334P probably damaging Het
Vps13c A G 9: 67,945,509 D2357G probably damaging Het
Zfp157 T C 5: 138,455,910 Y125H probably benign Het
Zfp747 A T 7: 127,374,647 M117K probably benign Het
Znrd1 A C 17: 36,957,830 probably null Het
Zscan4c A T 7: 11,009,731 N419I possibly damaging Het
Other mutations in Gga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Gga2 APN 7 122002188 missense probably damaging 1.00
IGL01577:Gga2 APN 7 121989783 missense probably damaging 1.00
IGL01584:Gga2 APN 7 121991538 missense probably benign
IGL01671:Gga2 APN 7 121994856 missense probably benign 0.01
IGL01680:Gga2 APN 7 121998076 missense probably benign 0.06
IGL02745:Gga2 APN 7 122008369 missense probably damaging 1.00
R0122:Gga2 UTSW 7 121991574 missense probably damaging 1.00
R0218:Gga2 UTSW 7 121998900 missense possibly damaging 0.46
R1367:Gga2 UTSW 7 121998915 nonsense probably null
R1774:Gga2 UTSW 7 122012221 missense probably damaging 0.98
R4127:Gga2 UTSW 7 122002720 missense probably damaging 1.00
R4510:Gga2 UTSW 7 122021078 missense unknown
R6319:Gga2 UTSW 7 122002166 missense possibly damaging 0.92
R6395:Gga2 UTSW 7 122008438 splice site probably null
R6486:Gga2 UTSW 7 122002188 missense probably damaging 1.00
R6952:Gga2 UTSW 7 121998888 missense probably benign 0.00
R7035:Gga2 UTSW 7 121989716 missense probably damaging 1.00
R7320:Gga2 UTSW 7 122002103 missense probably benign
R7454:Gga2 UTSW 7 122002146 missense probably benign 0.00
R7593:Gga2 UTSW 7 121990449 missense probably benign 0.00
R7602:Gga2 UTSW 7 121997330 missense probably benign 0.05
R7736:Gga2 UTSW 7 121990524 missense probably damaging 1.00
R8032:Gga2 UTSW 7 122020987 critical splice donor site probably null
R8803:Gga2 UTSW 7 121997779 missense probably benign 0.01
R8817:Gga2 UTSW 7 121991622 nonsense probably null
R9420:Gga2 UTSW 7 122003972 missense probably damaging 1.00
R9515:Gga2 UTSW 7 122012225 missense probably damaging 1.00
R9660:Gga2 UTSW 7 122007271 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TATACGGAACCAGATCCACCGG -3'
(R):5'- TGAGTAGATATACCTCTCTCCCATG -3'

Sequencing Primer
(F):5'- TACAGATAAAGGATGGTGCCC -3'
(R):5'- AGCCAGAGCTAATGATGG -3'
Posted On 2019-10-24