Incidental Mutation 'R7638:Megf11'
ID590074
Institutional Source Beutler Lab
Gene Symbol Megf11
Ensembl Gene ENSMUSG00000036466
Gene Namemultiple EGF-like-domains 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R7638 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location64385626-64709205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 64679253 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 422 (N422K)
Ref Sequence ENSEMBL: ENSMUSP00000091349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068967] [ENSMUST00000093829] [ENSMUST00000118485] [ENSMUST00000164113]
Predicted Effect probably damaging
Transcript: ENSMUST00000068967
AA Change: N453K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065353
Gene: ENSMUSG00000036466
AA Change: N453K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 74 84 N/A INTRINSIC
EGF 101 129 1.85e0 SMART
EGF_Lam 145 184 9.55e-3 SMART
EGF_Lam 188 227 2e-5 SMART
EGF 226 258 5.57e-4 SMART
EGF_Lam 274 313 1.26e-2 SMART
EGF_Lam 317 357 2.52e-2 SMART
EGF_Lam 361 402 4.16e-3 SMART
EGF 401 433 6.21e-2 SMART
EGF 444 476 4.1e-2 SMART
EGF 487 519 7.02e-1 SMART
EGF_Lam 535 574 1.43e-1 SMART
EGF_Lam 578 617 5.04e-2 SMART
EGF 616 650 8.52e0 SMART
EGF 661 693 9.41e-2 SMART
EGF 704 736 8.52e0 SMART
EGF_Lam 752 791 2.99e-4 SMART
EGF 790 822 1.14e0 SMART
transmembrane domain 848 870 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
low complexity region 1022 1037 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093829
AA Change: N422K

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091349
Gene: ENSMUSG00000036466
AA Change: N422K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 74 84 N/A INTRINSIC
EGF_Lam 114 153 9.55e-3 SMART
EGF_Lam 157 196 2e-5 SMART
EGF 195 227 5.57e-4 SMART
EGF_Lam 243 282 1.26e-2 SMART
EGF_Lam 286 326 2.52e-2 SMART
EGF_Lam 330 371 4.16e-3 SMART
EGF 370 402 6.21e-2 SMART
EGF 413 445 4.1e-2 SMART
EGF 456 488 7.02e-1 SMART
EGF_Lam 504 543 1.43e-1 SMART
EGF_Lam 547 586 5.04e-2 SMART
EGF 585 619 8.52e0 SMART
EGF 630 662 9.41e-2 SMART
EGF_Lam 678 717 2.99e-4 SMART
EGF 716 748 1.14e0 SMART
transmembrane domain 774 796 N/A INTRINSIC
low complexity region 821 835 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118485
AA Change: N453K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114035
Gene: ENSMUSG00000036466
AA Change: N453K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 74 84 N/A INTRINSIC
EGF 101 129 1.85e0 SMART
EGF_Lam 145 184 9.55e-3 SMART
EGF_Lam 188 227 2e-5 SMART
EGF 226 258 5.57e-4 SMART
EGF_Lam 274 313 1.26e-2 SMART
EGF_Lam 317 357 2.52e-2 SMART
EGF_Lam 361 402 4.16e-3 SMART
EGF 401 433 6.21e-2 SMART
EGF 444 476 4.1e-2 SMART
EGF 487 519 7.02e-1 SMART
EGF_Lam 535 574 1.43e-1 SMART
EGF_Lam 578 617 5.04e-2 SMART
EGF 616 650 8.52e0 SMART
EGF 661 693 9.41e-2 SMART
EGF 704 736 8.52e0 SMART
EGF_Lam 752 791 2.99e-4 SMART
EGF 790 822 1.14e0 SMART
transmembrane domain 848 870 N/A INTRINSIC
low complexity region 926 941 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000120514
Gene: ENSMUSG00000036466
AA Change: N43K

DomainStartEndE-ValueType
EGF_like 3 36 2.79e0 SMART
EGF 35 67 4.1e-2 SMART
EGF 78 110 7.02e-1 SMART
EGF_Lam 126 165 1.43e-1 SMART
EGF 164 196 1.64e-1 SMART
EGF_Lam 212 251 2.99e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164113
AA Change: N453K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128672
Gene: ENSMUSG00000036466
AA Change: N453K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 74 84 N/A INTRINSIC
EGF 101 129 1.85e0 SMART
EGF_Lam 145 184 9.55e-3 SMART
EGF_Lam 188 227 2e-5 SMART
EGF 226 258 5.57e-4 SMART
EGF_Lam 274 313 1.26e-2 SMART
EGF_Lam 317 357 2.52e-2 SMART
EGF_Lam 361 402 4.16e-3 SMART
EGF 401 433 6.21e-2 SMART
EGF 444 476 4.1e-2 SMART
EGF 487 519 7.02e-1 SMART
EGF_Lam 535 574 1.43e-1 SMART
EGF_Lam 578 617 5.04e-2 SMART
EGF 616 650 8.52e0 SMART
EGF 661 693 9.41e-2 SMART
EGF_Lam 709 748 2.99e-4 SMART
EGF 747 779 1.14e0 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 852 866 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of horizontal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,320,917 V161A probably damaging Het
Abo T G 2: 26,843,843 T115P probably damaging Het
Aggf1 G A 13: 95,356,413 R563* probably null Het
Amdhd1 A T 10: 93,534,498 Y159* probably null Het
BC027072 T C 17: 71,750,885 D599G probably damaging Het
C77080 T C 4: 129,221,941 T1022A probably benign Het
Camp T C 9: 109,848,393 E124G Het
Casq2 A G 3: 102,086,700 E21G possibly damaging Het
Cbln1 A T 8: 87,471,729 F116Y probably damaging Het
Cklf A T 8: 104,263,364 K143* probably null Het
Clca3a1 A G 3: 144,751,962 I387T probably damaging Het
Cndp1 T A 18: 84,636,049 D130V probably benign Het
Cyp4a12a T A 4: 115,327,473 M317K possibly damaging Het
D13Ertd608e A T 13: 119,842,688 probably null Het
Dmxl2 A T 9: 54,457,794 I138K unknown Het
Eapp A G 12: 54,673,723 S236P probably benign Het
Efnb3 T C 11: 69,557,220 H132R possibly damaging Het
Fbn2 A T 18: 58,105,136 N596K probably damaging Het
Fzd9 A G 5: 135,250,630 W134R probably damaging Het
Gga2 A G 7: 122,003,934 S180P probably damaging Het
Gm11639 T A 11: 105,036,799 M4798K probably benign Het
Gm30302 G T 13: 49,786,975 Q420K probably benign Het
Golga3 A G 5: 110,205,828 T911A probably benign Het
Gstm1 C T 3: 108,014,550 probably null Het
Heg1 A G 16: 33,727,497 T909A probably damaging Het
Herc2 C T 7: 56,220,525 R4349W probably damaging Het
Herc2 T C 7: 56,157,438 S2455P probably benign Het
Hivep2 T G 10: 14,143,851 M2122R possibly damaging Het
Itga10 T A 3: 96,657,391 probably null Het
Kbtbd13 G T 9: 65,391,323 C110* probably null Het
Krt78 T C 15: 101,950,883 E293G probably damaging Het
Lgals3bp C T 11: 118,398,169 V110M possibly damaging Het
Lrp2 A G 2: 69,477,008 probably null Het
Lrrc14 A G 15: 76,713,973 D301G probably benign Het
Lrrc71 C A 3: 87,741,806 G352W probably damaging Het
Map3k9 A G 12: 81,724,732 V694A probably benign Het
Mboat2 T C 12: 24,939,326 S162P probably damaging Het
Miga1 C T 3: 152,276,687 S584N probably benign Het
Mindy2 A G 9: 70,616,859 Y403H probably damaging Het
Mmd C T 11: 90,276,757 A204V possibly damaging Het
Mta3 A T 17: 83,800,143 Y262F probably benign Het
Ncoa7 G A 10: 30,722,798 S43F probably benign Het
Nphp4 T C 4: 152,554,534 V874A probably benign Het
Nsd1 A G 13: 55,312,328 T2226A probably benign Het
Nt5dc1 T C 10: 34,314,796 H302R probably benign Het
Odc1 A G 12: 17,550,002 Y389C probably damaging Het
Olfr175-ps1 G A 16: 58,824,595 T38I probably damaging Het
Olfr551 A G 7: 102,587,918 I275T probably damaging Het
Olfr970 T G 9: 39,819,893 F85V probably damaging Het
Pcdhb10 A C 18: 37,412,312 Q147P probably benign Het
Pdcl2 A C 5: 76,317,828 C182G probably damaging Het
Pigv T C 4: 133,665,451 D136G possibly damaging Het
Pramel5 T C 4: 144,271,440 E411G possibly damaging Het
Prkce T C 17: 86,168,600 V3A probably benign Het
Pth1r T C 9: 110,722,393 N546S probably benign Het
Qrich2 C T 11: 116,455,322 V1559I probably benign Het
Rbm20 A C 19: 53,814,333 D424A possibly damaging Het
Rbm26 C T 14: 105,150,848 D393N probably damaging Het
Sf3b3 G A 8: 110,820,813 R728C probably damaging Het
Srcap A G 7: 127,538,748 N1090S probably benign Het
Syt4 A T 18: 31,443,822 S160T probably benign Het
Tfap2e C T 4: 126,721,934 V236M probably damaging Het
Thsd4 G A 9: 60,394,472 T180M probably damaging Het
Tlr4 T A 4: 66,840,206 M412K probably damaging Het
Tmem67 T A 4: 12,079,883 H136L probably benign Het
Tnpo2 T A 8: 85,044,415 I110N probably benign Het
Trav13d-3 A G 14: 53,033,413 M111V probably benign Het
Tubb3 A T 8: 123,421,161 S278C probably benign Het
Ugcg T A 4: 59,220,299 F364Y probably benign Het
Usp17lc T C 7: 103,418,499 S334P probably damaging Het
Vps13c A G 9: 67,945,509 D2357G probably damaging Het
Zfp157 T C 5: 138,455,910 Y125H probably benign Het
Zfp747 A T 7: 127,374,647 M117K probably benign Het
Znrd1 A C 17: 36,957,830 probably null Het
Zscan4c A T 7: 11,009,731 N419I possibly damaging Het
Other mutations in Megf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Megf11 APN 9 64508727 missense probably damaging 1.00
IGL01285:Megf11 APN 9 64660446 missense probably damaging 1.00
IGL01309:Megf11 APN 9 64681416 missense probably benign 0.01
IGL01953:Megf11 APN 9 64690088 missense probably damaging 1.00
IGL02341:Megf11 APN 9 64544620 missense probably damaging 1.00
IGL02407:Megf11 APN 9 64680249 missense probably damaging 1.00
IGL02621:Megf11 APN 9 64693932 missense probably benign 0.07
R0277:Megf11 UTSW 9 64691350 critical splice donor site probably null
R0386:Megf11 UTSW 9 64640078 missense probably damaging 1.00
R1354:Megf11 UTSW 9 64653177 missense probably benign 0.00
R1709:Megf11 UTSW 9 64695412 missense probably damaging 1.00
R1865:Megf11 UTSW 9 64680299 missense probably benign 0.39
R1895:Megf11 UTSW 9 64679276 missense probably damaging 1.00
R1946:Megf11 UTSW 9 64679276 missense probably damaging 1.00
R2221:Megf11 UTSW 9 64660431 missense possibly damaging 0.63
R2223:Megf11 UTSW 9 64660431 missense possibly damaging 0.63
R3552:Megf11 UTSW 9 64695463 missense possibly damaging 0.75
R4641:Megf11 UTSW 9 64690125 missense possibly damaging 0.93
R4746:Megf11 UTSW 9 64508745 missense probably damaging 1.00
R5594:Megf11 UTSW 9 64686473 missense probably damaging 1.00
R5716:Megf11 UTSW 9 64506110 missense possibly damaging 0.72
R5898:Megf11 UTSW 9 64685964 missense probably damaging 1.00
R5960:Megf11 UTSW 9 64660449 missense probably benign 0.00
R6372:Megf11 UTSW 9 64706625 missense probably damaging 1.00
R6811:Megf11 UTSW 9 64544641 missense probably damaging 0.99
R6868:Megf11 UTSW 9 64680309 missense probably damaging 1.00
R6980:Megf11 UTSW 9 64705850 missense probably damaging 1.00
R6984:Megf11 UTSW 9 64686452 missense probably benign
R7155:Megf11 UTSW 9 64647951 missense probably null 1.00
R7643:Megf11 UTSW 9 64706632 missense probably damaging 1.00
R7688:Megf11 UTSW 9 64691864 missense possibly damaging 0.92
R7840:Megf11 UTSW 9 64695427 missense possibly damaging 0.94
V5088:Megf11 UTSW 9 64690069 nonsense probably null
V5622:Megf11 UTSW 9 64690069 nonsense probably null
V5622:Megf11 UTSW 9 64690069 nonsense probably null
Z1088:Megf11 UTSW 9 64660476 missense probably damaging 1.00
Z1177:Megf11 UTSW 9 64680326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTTGGAAGCATGGACATC -3'
(R):5'- ATTGTCCCTGCAGACCATG -3'

Sequencing Primer
(F):5'- CATGGACATCAGGAGGAGCACC -3'
(R):5'- TGCAGACCATGTGGCTCAC -3'
Posted On2019-10-24