Incidental Mutation 'R7638:Nt5dc1'
ID590082
Institutional Source Beutler Lab
Gene Symbol Nt5dc1
Ensembl Gene ENSMUSG00000039480
Gene Name5'-nucleotidase domain containing 1
SynonymsNt5c2l1, 6030401B09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7638 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location34288288-34418552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34314796 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 302 (H302R)
Ref Sequence ENSEMBL: ENSMUSP00000047126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047885] [ENSMUST00000105512]
Predicted Effect probably benign
Transcript: ENSMUST00000047885
AA Change: H302R

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000047126
Gene: ENSMUSG00000039480
AA Change: H302R

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 382 2.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105512
AA Change: H301R

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101151
Gene: ENSMUSG00000039480
AA Change: H301R

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 372 8.7e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129363
Meta Mutation Damage Score 0.1305 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] While the exact function of the protein encoded by this gene is not known, it belongs to the 5'(3')-deoxyribonucleotidase family. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,320,917 V161A probably damaging Het
Abo T G 2: 26,843,843 T115P probably damaging Het
Aggf1 G A 13: 95,356,413 R563* probably null Het
Amdhd1 A T 10: 93,534,498 Y159* probably null Het
BC027072 T C 17: 71,750,885 D599G probably damaging Het
C77080 T C 4: 129,221,941 T1022A probably benign Het
Camp T C 9: 109,848,393 E124G Het
Casq2 A G 3: 102,086,700 E21G possibly damaging Het
Cbln1 A T 8: 87,471,729 F116Y probably damaging Het
Cklf A T 8: 104,263,364 K143* probably null Het
Clca3a1 A G 3: 144,751,962 I387T probably damaging Het
Cndp1 T A 18: 84,636,049 D130V probably benign Het
Cyp4a12a T A 4: 115,327,473 M317K possibly damaging Het
D13Ertd608e A T 13: 119,842,688 probably null Het
Dmxl2 A T 9: 54,457,794 I138K unknown Het
Eapp A G 12: 54,673,723 S236P probably benign Het
Efnb3 T C 11: 69,557,220 H132R possibly damaging Het
Fbn2 A T 18: 58,105,136 N596K probably damaging Het
Fzd9 A G 5: 135,250,630 W134R probably damaging Het
Gga2 A G 7: 122,003,934 S180P probably damaging Het
Gm11639 T A 11: 105,036,799 M4798K probably benign Het
Gm30302 G T 13: 49,786,975 Q420K probably benign Het
Golga3 A G 5: 110,205,828 T911A probably benign Het
Gstm1 C T 3: 108,014,550 probably null Het
Heg1 A G 16: 33,727,497 T909A probably damaging Het
Herc2 T C 7: 56,157,438 S2455P probably benign Het
Herc2 C T 7: 56,220,525 R4349W probably damaging Het
Hivep2 T G 10: 14,143,851 M2122R possibly damaging Het
Itga10 T A 3: 96,657,391 probably null Het
Kbtbd13 G T 9: 65,391,323 C110* probably null Het
Krt78 T C 15: 101,950,883 E293G probably damaging Het
Lgals3bp C T 11: 118,398,169 V110M possibly damaging Het
Lrp2 A G 2: 69,477,008 probably null Het
Lrrc14 A G 15: 76,713,973 D301G probably benign Het
Lrrc71 C A 3: 87,741,806 G352W probably damaging Het
Map3k9 A G 12: 81,724,732 V694A probably benign Het
Mboat2 T C 12: 24,939,326 S162P probably damaging Het
Megf11 C A 9: 64,679,253 N422K probably damaging Het
Miga1 C T 3: 152,276,687 S584N probably benign Het
Mindy2 A G 9: 70,616,859 Y403H probably damaging Het
Mmd C T 11: 90,276,757 A204V possibly damaging Het
Mta3 A T 17: 83,800,143 Y262F probably benign Het
Ncoa7 G A 10: 30,722,798 S43F probably benign Het
Nphp4 T C 4: 152,554,534 V874A probably benign Het
Nsd1 A G 13: 55,312,328 T2226A probably benign Het
Odc1 A G 12: 17,550,002 Y389C probably damaging Het
Olfr175-ps1 G A 16: 58,824,595 T38I probably damaging Het
Olfr551 A G 7: 102,587,918 I275T probably damaging Het
Olfr970 T G 9: 39,819,893 F85V probably damaging Het
Pcdhb10 A C 18: 37,412,312 Q147P probably benign Het
Pdcl2 A C 5: 76,317,828 C182G probably damaging Het
Pigv T C 4: 133,665,451 D136G possibly damaging Het
Pramel5 T C 4: 144,271,440 E411G possibly damaging Het
Prkce T C 17: 86,168,600 V3A probably benign Het
Pth1r T C 9: 110,722,393 N546S probably benign Het
Qrich2 C T 11: 116,455,322 V1559I probably benign Het
Rbm20 A C 19: 53,814,333 D424A possibly damaging Het
Rbm26 C T 14: 105,150,848 D393N probably damaging Het
Sf3b3 G A 8: 110,820,813 R728C probably damaging Het
Srcap A G 7: 127,538,748 N1090S probably benign Het
Syt4 A T 18: 31,443,822 S160T probably benign Het
Tfap2e C T 4: 126,721,934 V236M probably damaging Het
Thsd4 G A 9: 60,394,472 T180M probably damaging Het
Tlr4 T A 4: 66,840,206 M412K probably damaging Het
Tmem67 T A 4: 12,079,883 H136L probably benign Het
Tnpo2 T A 8: 85,044,415 I110N probably benign Het
Trav13d-3 A G 14: 53,033,413 M111V probably benign Het
Tubb3 A T 8: 123,421,161 S278C probably benign Het
Ugcg T A 4: 59,220,299 F364Y probably benign Het
Usp17lc T C 7: 103,418,499 S334P probably damaging Het
Vps13c A G 9: 67,945,509 D2357G probably damaging Het
Zfp157 T C 5: 138,455,910 Y125H probably benign Het
Zfp747 A T 7: 127,374,647 M117K probably benign Het
Znrd1 A C 17: 36,957,830 probably null Het
Zscan4c A T 7: 11,009,731 N419I possibly damaging Het
Other mutations in Nt5dc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Nt5dc1 APN 10 34407557 missense possibly damaging 0.80
IGL02096:Nt5dc1 APN 10 34399810 nonsense probably null
IGL02471:Nt5dc1 APN 10 34403725 missense probably benign 0.03
IGL03345:Nt5dc1 APN 10 34324462 missense probably benign 0.04
R0083:Nt5dc1 UTSW 10 34403764 missense probably damaging 0.98
R1159:Nt5dc1 UTSW 10 34398173 missense possibly damaging 0.93
R1898:Nt5dc1 UTSW 10 34313635 missense probably benign 0.00
R1901:Nt5dc1 UTSW 10 34313671 missense probably damaging 1.00
R2327:Nt5dc1 UTSW 10 34313677 missense possibly damaging 0.66
R4365:Nt5dc1 UTSW 10 34310381 missense probably benign 0.20
R4942:Nt5dc1 UTSW 10 34322677 missense probably damaging 1.00
R4943:Nt5dc1 UTSW 10 34310391 missense probably damaging 1.00
R5168:Nt5dc1 UTSW 10 34397240 missense probably benign 0.05
R5507:Nt5dc1 UTSW 10 34397230 missense probably benign
R5605:Nt5dc1 UTSW 10 34403695 missense probably benign 0.12
R6406:Nt5dc1 UTSW 10 34324408 missense probably benign 0.04
R6495:Nt5dc1 UTSW 10 34324369 missense probably damaging 1.00
R6799:Nt5dc1 UTSW 10 34313707 missense possibly damaging 0.79
R6835:Nt5dc1 UTSW 10 34310379 missense probably benign 0.04
R7480:Nt5dc1 UTSW 10 34324453 missense probably damaging 1.00
R7480:Nt5dc1 UTSW 10 34324454 missense probably damaging 1.00
R7486:Nt5dc1 UTSW 10 34399809 missense probably benign 0.26
R7493:Nt5dc1 UTSW 10 34304936 missense probably benign 0.00
R8042:Nt5dc1 UTSW 10 34397214 missense probably benign 0.19
R8160:Nt5dc1 UTSW 10 34324396 missense possibly damaging 0.79
R8268:Nt5dc1 UTSW 10 34310411 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGGCCTCTCTGGAATCC -3'
(R):5'- GTGCTTACTGAATGCGCAC -3'

Sequencing Primer
(F):5'- GACTGAGTATCTACCAAGAGTGCATC -3'
(R):5'- ACTGAATGCGCACATGCTTTC -3'
Posted On2019-10-24