Incidental Mutation 'R7638:Qrich2'
ID 590087
Institutional Source Beutler Lab
Gene Symbol Qrich2
Ensembl Gene ENSMUSG00000070331
Gene Name glutamine rich 2
Synonyms LOC217341
MMRRC Submission 045696-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R7638 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 116332151-116357067 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 116346148 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1559 (V1559I)
Ref Sequence ENSEMBL: ENSMUSP00000147009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093909] [ENSMUST00000208602]
AlphaFold Q3V2A7
Predicted Effect probably benign
Transcript: ENSMUST00000093909
SMART Domains Protein: ENSMUSP00000091437
Gene: ENSMUSG00000070331

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Pfam:DUF4795 97 304 3.7e-71 PFAM
low complexity region 471 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208602
AA Change: V1559I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abo T G 2: 26,733,855 (GRCm39) T115P probably damaging Het
Aggf1 G A 13: 95,492,921 (GRCm39) R563* probably null Het
Amdhd1 A T 10: 93,370,360 (GRCm39) Y159* probably null Het
Camp T C 9: 109,677,461 (GRCm39) E124G Het
Casq2 A G 3: 101,994,016 (GRCm39) E21G possibly damaging Het
Cbln1 A T 8: 88,198,357 (GRCm39) F116Y probably damaging Het
Cklf A T 8: 104,989,996 (GRCm39) K143* probably null Het
Clca3a1 A G 3: 144,457,723 (GRCm39) I387T probably damaging Het
Cndp1 T A 18: 84,654,174 (GRCm39) D130V probably benign Het
Cyp4a12a T A 4: 115,184,670 (GRCm39) M317K possibly damaging Het
Dmxl2 A T 9: 54,365,078 (GRCm39) I138K unknown Het
Eapp A G 12: 54,720,508 (GRCm39) S236P probably benign Het
Efcab3 T A 11: 104,927,625 (GRCm39) M4798K probably benign Het
Efnb3 T C 11: 69,448,046 (GRCm39) H132R possibly damaging Het
Fam243 A G 16: 92,117,805 (GRCm39) V161A probably damaging Het
Fbn2 A T 18: 58,238,208 (GRCm39) N596K probably damaging Het
Fzd9 A G 5: 135,279,484 (GRCm39) W134R probably damaging Het
Gga2 A G 7: 121,603,157 (GRCm39) S180P probably damaging Het
Golga3 A G 5: 110,353,694 (GRCm39) T911A probably benign Het
Gstm1 C T 3: 107,921,866 (GRCm39) probably null Het
Heg1 A G 16: 33,547,867 (GRCm39) T909A probably damaging Het
Herc2 T C 7: 55,807,186 (GRCm39) S2455P probably benign Het
Herc2 C T 7: 55,870,273 (GRCm39) R4349W probably damaging Het
Hivep2 T G 10: 14,019,595 (GRCm39) M2122R possibly damaging Het
Itga10 T A 3: 96,564,707 (GRCm39) probably null Het
Kbtbd13 G T 9: 65,298,605 (GRCm39) C110* probably null Het
Krt78 T C 15: 101,859,318 (GRCm39) E293G probably damaging Het
Lgals3bp C T 11: 118,288,995 (GRCm39) V110M possibly damaging Het
Lrp2 A G 2: 69,307,352 (GRCm39) probably null Het
Lrrc14 A G 15: 76,598,173 (GRCm39) D301G probably benign Het
Lrrc71 C A 3: 87,649,113 (GRCm39) G352W probably damaging Het
Map3k9 A G 12: 81,771,506 (GRCm39) V694A probably benign Het
Mboat2 T C 12: 24,989,325 (GRCm39) S162P probably damaging Het
Megf11 C A 9: 64,586,535 (GRCm39) N422K probably damaging Het
Miga1 C T 3: 151,982,324 (GRCm39) S584N probably benign Het
Mindy2 A G 9: 70,524,141 (GRCm39) Y403H probably damaging Het
Mmd C T 11: 90,167,583 (GRCm39) A204V possibly damaging Het
Mta3 A T 17: 84,107,572 (GRCm39) Y262F probably benign Het
Ncoa7 G A 10: 30,598,794 (GRCm39) S43F probably benign Het
Nhsl3 T C 4: 129,115,734 (GRCm39) T1022A probably benign Het
Nphp4 T C 4: 152,638,991 (GRCm39) V874A probably benign Het
Nsd1 A G 13: 55,460,141 (GRCm39) T2226A probably benign Het
Nt5dc1 T C 10: 34,190,792 (GRCm39) H302R probably benign Het
Odc1 A G 12: 17,600,003 (GRCm39) Y389C probably damaging Het
Or52p2 A G 7: 102,237,125 (GRCm39) I275T probably damaging Het
Or5k8 G A 16: 58,644,958 (GRCm39) T38I probably damaging Het
Or8g37 T G 9: 39,731,189 (GRCm39) F85V probably damaging Het
Pcare T C 17: 72,057,880 (GRCm39) D599G probably damaging Het
Pcdhb10 A C 18: 37,545,365 (GRCm39) Q147P probably benign Het
Pdcl2 A C 5: 76,465,675 (GRCm39) C182G probably damaging Het
Pigv T C 4: 133,392,762 (GRCm39) D136G possibly damaging Het
Polr1h A C 17: 37,268,722 (GRCm39) probably null Het
Pramel5 T C 4: 143,998,010 (GRCm39) E411G possibly damaging Het
Prkce T C 17: 86,476,028 (GRCm39) V3A probably benign Het
Pth1r T C 9: 110,551,461 (GRCm39) N546S probably benign Het
Rbm20 A C 19: 53,802,764 (GRCm39) D424A possibly damaging Het
Rbm26 C T 14: 105,388,284 (GRCm39) D393N probably damaging Het
Sf3b3 G A 8: 111,547,445 (GRCm39) R728C probably damaging Het
Spata31e1 G T 13: 49,940,451 (GRCm39) Q420K probably benign Het
Srcap A G 7: 127,137,920 (GRCm39) N1090S probably benign Het
Syt4 A T 18: 31,576,875 (GRCm39) S160T probably benign Het
Tcstv6 A T 13: 120,304,224 (GRCm39) probably null Het
Tfap2e C T 4: 126,615,727 (GRCm39) V236M probably damaging Het
Thsd4 G A 9: 60,301,755 (GRCm39) T180M probably damaging Het
Tlr4 T A 4: 66,758,443 (GRCm39) M412K probably damaging Het
Tmem67 T A 4: 12,079,883 (GRCm39) H136L probably benign Het
Tnpo2 T A 8: 85,771,044 (GRCm39) I110N probably benign Het
Trav13d-3 A G 14: 53,270,870 (GRCm39) M111V probably benign Het
Tubb3 A T 8: 124,147,900 (GRCm39) S278C probably benign Het
Ugcg T A 4: 59,220,299 (GRCm39) F364Y probably benign Het
Usp17lc T C 7: 103,067,706 (GRCm39) S334P probably damaging Het
Vps13c A G 9: 67,852,791 (GRCm39) D2357G probably damaging Het
Zfp157 T C 5: 138,454,172 (GRCm39) Y125H probably benign Het
Zfp747 A T 7: 126,973,819 (GRCm39) M117K probably benign Het
Zscan4c A T 7: 10,743,658 (GRCm39) N419I possibly damaging Het
Other mutations in Qrich2
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4449:Qrich2 UTSW 11 116,347,025 (GRCm39) small deletion probably benign
R0122:Qrich2 UTSW 11 116,337,639 (GRCm39) missense possibly damaging 0.61
R0157:Qrich2 UTSW 11 116,332,221 (GRCm39) missense probably damaging 1.00
R1479:Qrich2 UTSW 11 116,332,311 (GRCm39) missense probably benign 0.08
R1786:Qrich2 UTSW 11 116,332,275 (GRCm39) missense probably damaging 1.00
R2115:Qrich2 UTSW 11 116,337,982 (GRCm39) missense probably damaging 0.99
R2130:Qrich2 UTSW 11 116,339,243 (GRCm39) splice site probably benign
R2178:Qrich2 UTSW 11 116,334,603 (GRCm39) missense probably damaging 1.00
R3875:Qrich2 UTSW 11 116,336,477 (GRCm39) missense probably damaging 0.98
R4378:Qrich2 UTSW 11 116,337,741 (GRCm39) missense probably damaging 1.00
R5124:Qrich2 UTSW 11 116,337,599 (GRCm39) missense probably damaging 1.00
R5362:Qrich2 UTSW 11 116,337,976 (GRCm39) missense probably damaging 1.00
R5468:Qrich2 UTSW 11 116,339,191 (GRCm39) missense probably damaging 1.00
R5493:Qrich2 UTSW 11 116,336,774 (GRCm39) critical splice donor site probably null
R5589:Qrich2 UTSW 11 116,332,234 (GRCm39) missense probably damaging 1.00
R5696:Qrich2 UTSW 11 116,335,828 (GRCm39) missense probably damaging 1.00
R6046:Qrich2 UTSW 11 116,337,832 (GRCm39) intron probably benign
R6183:Qrich2 UTSW 11 116,348,955 (GRCm39) unclassified probably benign
R6193:Qrich2 UTSW 11 116,344,979 (GRCm39) missense probably benign 0.07
R6211:Qrich2 UTSW 11 116,344,368 (GRCm39) missense probably benign 0.41
R6375:Qrich2 UTSW 11 116,349,054 (GRCm39) unclassified probably benign
R6452:Qrich2 UTSW 11 116,346,714 (GRCm39) missense probably benign 0.01
R6870:Qrich2 UTSW 11 116,346,156 (GRCm39) missense probably damaging 0.96
R7073:Qrich2 UTSW 11 116,337,701 (GRCm39) missense probably damaging 0.98
R7552:Qrich2 UTSW 11 116,347,080 (GRCm39) missense possibly damaging 0.63
R7585:Qrich2 UTSW 11 116,346,547 (GRCm39) missense probably benign 0.00
R7586:Qrich2 UTSW 11 116,346,450 (GRCm39) missense probably benign 0.43
R7588:Qrich2 UTSW 11 116,356,763 (GRCm39) missense possibly damaging 0.53
R7633:Qrich2 UTSW 11 116,347,455 (GRCm39) missense unknown
R7736:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R7737:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R7753:Qrich2 UTSW 11 116,347,868 (GRCm39) small deletion probably benign
R7800:Qrich2 UTSW 11 116,347,686 (GRCm39) nonsense probably null
R7833:Qrich2 UTSW 11 116,346,591 (GRCm39) missense probably benign 0.04
R7912:Qrich2 UTSW 11 116,346,608 (GRCm39) small deletion probably benign
R7923:Qrich2 UTSW 11 116,348,163 (GRCm39) missense probably damaging 1.00
R8197:Qrich2 UTSW 11 116,347,861 (GRCm39) small deletion probably benign
R8225:Qrich2 UTSW 11 116,344,894 (GRCm39) missense probably damaging 1.00
R8300:Qrich2 UTSW 11 116,347,175 (GRCm39) missense probably benign 0.04
R8391:Qrich2 UTSW 11 116,356,403 (GRCm39) missense probably benign 0.00
R8705:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R8792:Qrich2 UTSW 11 116,347,456 (GRCm39) missense unknown
R8912:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R9025:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R9121:Qrich2 UTSW 11 116,347,272 (GRCm39) missense unknown
R9130:Qrich2 UTSW 11 116,347,692 (GRCm39) nonsense probably null
R9219:Qrich2 UTSW 11 116,335,900 (GRCm39) missense possibly damaging 0.47
R9254:Qrich2 UTSW 11 116,348,934 (GRCm39) missense unknown
R9256:Qrich2 UTSW 11 116,356,450 (GRCm39) missense probably benign 0.10
R9288:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R9379:Qrich2 UTSW 11 116,348,934 (GRCm39) missense unknown
R9448:Qrich2 UTSW 11 116,338,091 (GRCm39) missense probably benign 0.01
R9521:Qrich2 UTSW 11 116,339,208 (GRCm39) missense probably damaging 1.00
R9620:Qrich2 UTSW 11 116,337,946 (GRCm39) missense probably damaging 1.00
R9631:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R9639:Qrich2 UTSW 11 116,346,924 (GRCm39) missense probably benign 0.00
R9694:Qrich2 UTSW 11 116,337,946 (GRCm39) missense probably damaging 1.00
Z1176:Qrich2 UTSW 11 116,347,204 (GRCm39) missense probably benign 0.00
Z1177:Qrich2 UTSW 11 116,347,494 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ATCAGGCGCAGTGTTTCCAC -3'
(R):5'- ATAGACCTTCGCTTTCCAACAATG -3'

Sequencing Primer
(F):5'- AGTGTTTCCACCGCCATGG -3'
(R):5'- GTTGAACCTCAGCAACCACAATTG -3'
Posted On 2019-10-24