Incidental Mutation 'R0234:Sirpa'
ID59009
Institutional Source Beutler Lab
Gene Symbol Sirpa
Ensembl Gene ENSMUSG00000037902
Gene Namesignal-regulatory protein alpha
SynonymsSIRP, Ptpns1, CD172a, P84, SHPS-1, Bit
MMRRC Submission 038475-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0234 (G1)
Quality Score202
Status Not validated
Chromosome2
Chromosomal Location129592835-129632228 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129615468 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 154 (V154A)
Ref Sequence ENSEMBL: ENSMUSP00000124048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049262] [ENSMUST00000099113] [ENSMUST00000103202] [ENSMUST00000103203] [ENSMUST00000153491] [ENSMUST00000160276] [ENSMUST00000161620] [ENSMUST00000163034] [ENSMUST00000179001]
Predicted Effect probably damaging
Transcript: ENSMUST00000049262
AA Change: V154A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049022
Gene: ENSMUSG00000037902
AA Change: V154A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099113
SMART Domains Protein: ENSMUSP00000096713
Gene: ENSMUSG00000037902

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
transmembrane domain 156 178 N/A INTRINSIC
low complexity region 228 240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103202
AA Change: V154A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099491
Gene: ENSMUSG00000037902
AA Change: V154A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103203
AA Change: V154A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099492
Gene: ENSMUSG00000037902
AA Change: V154A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153491
SMART Domains Protein: ENSMUSP00000120324
Gene: ENSMUSG00000037902

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160276
SMART Domains Protein: ENSMUSP00000125004
Gene: ENSMUSG00000037902

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
transmembrane domain 156 178 N/A INTRINSIC
low complexity region 224 236 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160952
Predicted Effect probably damaging
Transcript: ENSMUST00000161620
AA Change: V154A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124048
Gene: ENSMUSG00000037902
AA Change: V154A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163034
SMART Domains Protein: ENSMUSP00000124888
Gene: ENSMUSG00000037902

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
low complexity region 105 117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179001
AA Change: V154A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137611
Gene: ENSMUSG00000037902
AA Change: V154A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the signal-regulatory-protein (SIRP) family, and also belongs to the immunoglobulin superfamily. SIRP family members are receptor-type transmembrane glycoproteins known to be involved in the negative regulation of receptor tyrosine kinase-coupled signaling processes. This protein can be phosphorylated by tyrosine kinases. The phospho-tyrosine residues of this PTP have been shown to recruit SH2 domain containing tyrosine phosphatases (PTP), and serve as substrates of PTPs. This protein was found to participate in signal transduction mediated by various growth factor receptors. CD47 has been demonstrated to be a ligand for this receptor protein. This gene and its product share very high similarity with several other members of the SIRP family. These related genes are located in close proximity to each other on chromosome 20p13. Multiple alternatively spliced transcript variants have been determined for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display mild thrombocytopenia, fatty livers, decreased body weight, decreased proportion of single positive T cells, enhanced peritoneal macrophage phagocytosis and impaired Langerhans cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T A 7: 131,194,303 probably null Het
A3galt2 A G 4: 128,767,148 R197G possibly damaging Het
Acacb A T 5: 114,209,817 H983L probably damaging Het
Adal T A 2: 121,148,317 D139E probably benign Het
Adam6b G A 12: 113,490,610 R349H probably damaging Het
Agap1 A G 1: 89,671,212 K331E probably damaging Het
Alyref T C 11: 120,598,307 D11G probably damaging Het
B3gat1 A G 9: 26,756,081 E203G probably damaging Het
Bsn T C 9: 108,116,396 E719G possibly damaging Het
Cap2 G C 13: 46,638,022 probably null Het
Ccni A G 5: 93,202,327 V31A probably benign Het
Cfap54 A T 10: 92,899,160 L2343* probably null Het
Clns1a T A 7: 97,714,032 Y204N possibly damaging Het
Cox11 C T 11: 90,644,500 T259I probably damaging Het
D430042O09Rik T C 7: 125,795,385 V211A probably benign Het
Dsp A G 13: 38,187,893 N940S probably benign Het
Erbb2 T C 11: 98,436,439 V1181A probably benign Het
Exoc4 T C 6: 33,862,087 V686A possibly damaging Het
F830045P16Rik A G 2: 129,463,464 V330A possibly damaging Het
Fam71a T C 1: 191,162,908 S513G probably benign Het
Fbf1 A C 11: 116,155,034 F245V probably damaging Het
Fut10 T A 8: 31,236,197 F327I probably damaging Het
Galnt1 C T 18: 24,254,633 P144S probably damaging Het
Ghrhr A T 6: 55,379,186 D88V possibly damaging Het
Greb1l T A 18: 10,560,331 C1864S probably damaging Het
Hist1h1c T C 13: 23,739,123 I92T probably benign Het
Hps1 T C 19: 42,762,553 E336G probably damaging Het
Ibsp GGAAGAAGAAGAAGAAGA GGAAGAAGAAGAAGA 5: 104,310,069 probably benign Het
Irgc1 C A 7: 24,433,328 E21D possibly damaging Het
Itsn1 A T 16: 91,828,280 R590* probably null Het
Lmln T C 16: 33,066,324 V67A probably damaging Het
Lsm14a T C 7: 34,365,617 Q179R probably damaging Het
Ltbr A C 6: 125,312,873 D119E probably benign Het
Mrc1 A G 2: 14,279,894 T565A possibly damaging Het
Muc6 A C 7: 141,649,674 N473K possibly damaging Het
Myocd A T 11: 65,187,240 D448E probably benign Het
Neil2 T A 14: 63,183,526 I239F probably damaging Het
Npnt A G 3: 132,914,414 F123S possibly damaging Het
Olfr1164 T A 2: 88,093,022 R305* probably null Het
Olfr117 T A 17: 37,660,106 I76F probably damaging Het
Olfr1309 T C 2: 111,983,300 Y258C probably damaging Het
Olfr1501 C T 19: 13,838,538 V212M possibly damaging Het
Olfr683 T C 7: 105,144,074 D73G probably damaging Het
Olfr686 C A 7: 105,203,614 C243F probably damaging Het
Olfr933 A C 9: 38,976,251 probably null Het
Pcnx3 T C 19: 5,672,618 T941A probably benign Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Pitrm1 C A 13: 6,575,079 Y864* probably null Het
Plcb4 T C 2: 135,982,075 I844T probably benign Het
Plekhg5 T C 4: 152,112,219 C695R probably damaging Het
Ppp1r3b T A 8: 35,384,501 F165I probably damaging Het
Prr5 T A 15: 84,703,121 F357L probably damaging Het
Rasgrf1 A T 9: 90,009,366 I1046F probably damaging Het
Rbm15b T C 9: 106,885,364 Y535C probably damaging Het
Rbp3 A T 14: 33,955,901 E602V probably damaging Het
Rimklb T C 6: 122,456,333 N343S probably benign Het
Rrp12 A G 19: 41,871,760 L1008P probably damaging Het
Sec63 C T 10: 42,798,798 R226C probably damaging Het
Slc13a5 C G 11: 72,250,800 V405L probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc22a23 G A 13: 34,183,261 T588I probably damaging Het
Slc22a27 C A 19: 7,926,791 probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc5a5 A T 8: 70,889,633 M258K probably damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Stk11ip A G 1: 75,529,067 D460G possibly damaging Het
Syn3 T A 10: 86,448,886 I117F possibly damaging Het
Tead4 C T 6: 128,243,402 A224T probably damaging Het
Tmtc3 A T 10: 100,450,322 N546K probably benign Het
Tnn T A 1: 160,088,466 H1227L probably damaging Het
Tor2a G A 2: 32,758,704 G62D probably damaging Het
Trf T C 9: 103,226,879 probably null Het
Ubr5 T C 15: 37,968,493 T2727A probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Wipf3 T G 6: 54,496,501 L458R probably damaging Het
Zfp236 T C 18: 82,629,994 K966R probably damaging Het
Zfp27 T A 7: 29,894,107 H811L possibly damaging Het
Zfp366 A G 13: 99,234,260 H496R probably damaging Het
Zfp467 A T 6: 48,438,755 V321E probably damaging Het
Other mutations in Sirpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Sirpa APN 2 129609183 missense probably damaging 1.00
IGL01138:Sirpa APN 2 129630165 missense probably damaging 1.00
IGL01835:Sirpa APN 2 129615564 missense possibly damaging 0.76
IGL02558:Sirpa APN 2 129630069 missense probably damaging 1.00
IGL02825:Sirpa APN 2 129615452 missense probably damaging 0.99
IGL03083:Sirpa APN 2 129629928 missense probably damaging 1.00
R0234:Sirpa UTSW 2 129615468 missense probably damaging 0.99
R0831:Sirpa UTSW 2 129627936 splice site probably benign
R1550:Sirpa UTSW 2 129630041 missense probably damaging 1.00
R1772:Sirpa UTSW 2 129616456 missense probably damaging 0.99
R1806:Sirpa UTSW 2 129615512 missense probably damaging 1.00
R1927:Sirpa UTSW 2 129616376 missense possibly damaging 0.46
R2568:Sirpa UTSW 2 129615648 missense probably benign 0.02
R4849:Sirpa UTSW 2 129609243 missense probably damaging 1.00
R5182:Sirpa UTSW 2 129615732 missense possibly damaging 0.65
R5673:Sirpa UTSW 2 129630102 missense probably damaging 1.00
R5680:Sirpa UTSW 2 129616252 missense probably benign 0.02
R6521:Sirpa UTSW 2 129630155 missense probably damaging 1.00
R6821:Sirpa UTSW 2 129630097 missense probably damaging 1.00
R7602:Sirpa UTSW 2 129609152 missense probably damaging 1.00
R7637:Sirpa UTSW 2 129616445 missense probably benign 0.44
RF018:Sirpa UTSW 2 129609203 nonsense probably null
RF049:Sirpa UTSW 2 129609203 nonsense probably null
Z1088:Sirpa UTSW 2 129618535 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTGTCACCAGTCTAGAGACGCC -3'
(R):5'- GACAGGTTAGCAATCCCACGAAGAG -3'

Sequencing Primer
(F):5'- ACGCCATACGGTTTAGTAGTAG -3'
(R):5'- ATGGAGTTTAGTACCACCCTGAC -3'
Posted On2013-07-11