Incidental Mutation 'R7638:Lrrc14'
ID590098
Institutional Source Beutler Lab
Gene Symbol Lrrc14
Ensembl Gene ENSMUSG00000033728
Gene Nameleucine rich repeat containing 14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7638 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76710623-76717699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76713973 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 301 (D301G)
Ref Sequence ENSEMBL: ENSMUSP00000115446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036423] [ENSMUST00000036852] [ENSMUST00000049956] [ENSMUST00000127208] [ENSMUST00000136840] [ENSMUST00000137649] [ENSMUST00000142610] [ENSMUST00000155225] [ENSMUST00000155735] [ENSMUST00000230544] [ENSMUST00000230724]
Predicted Effect probably benign
Transcript: ENSMUST00000036423
AA Change: D301G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000049466
Gene: ENSMUSG00000033728
AA Change: D301G

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036852
SMART Domains Protein: ENSMUSP00000044363
Gene: ENSMUSG00000033762

DomainStartEndE-ValueType
Pfam:Drc1-Sld2 4 132 2.8e-14 PFAM
low complexity region 169 187 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
ZnF_C2HC 394 410 5.67e-5 SMART
DEXDc 494 701 5.86e-28 SMART
HELICc 736 831 1.48e-24 SMART
Blast:DEXDc 902 1117 3e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000049956
SMART Domains Protein: ENSMUSP00000061906
Gene: ENSMUSG00000033707

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 30 62 1.04e-2 SMART
LRR 61 80 3.18e2 SMART
LRR_TYP 81 104 2.99e-4 SMART
LRR 106 128 3.87e1 SMART
LRR_TYP 129 152 8.22e-2 SMART
LRR_TYP 153 176 5.06e-2 SMART
LRR 177 200 2.02e-1 SMART
LRRCT 212 266 2e-10 SMART
IGc2 280 360 1.02e-9 SMART
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127208
AA Change: D301G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000114921
Gene: ENSMUSG00000033728
AA Change: D301G

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136840
SMART Domains Protein: ENSMUSP00000119670
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137649
AA Change: D301G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000121982
Gene: ENSMUSG00000033728
AA Change: D301G

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142506
Predicted Effect probably benign
Transcript: ENSMUST00000142610
SMART Domains Protein: ENSMUSP00000117780
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154531
Predicted Effect probably benign
Transcript: ENSMUST00000155225
Predicted Effect probably benign
Transcript: ENSMUST00000155735
AA Change: D301G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000115446
Gene: ENSMUSG00000033728
AA Change: D301G

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229360
Predicted Effect probably benign
Transcript: ENSMUST00000230544
Predicted Effect probably benign
Transcript: ENSMUST00000230724
Meta Mutation Damage Score 0.0602 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich repeat-containing protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,320,917 V161A probably damaging Het
Abo T G 2: 26,843,843 T115P probably damaging Het
Aggf1 G A 13: 95,356,413 R563* probably null Het
Amdhd1 A T 10: 93,534,498 Y159* probably null Het
BC027072 T C 17: 71,750,885 D599G probably damaging Het
C77080 T C 4: 129,221,941 T1022A probably benign Het
Camp T C 9: 109,848,393 E124G Het
Casq2 A G 3: 102,086,700 E21G possibly damaging Het
Cbln1 A T 8: 87,471,729 F116Y probably damaging Het
Cklf A T 8: 104,263,364 K143* probably null Het
Clca3a1 A G 3: 144,751,962 I387T probably damaging Het
Cndp1 T A 18: 84,636,049 D130V probably benign Het
Cyp4a12a T A 4: 115,327,473 M317K possibly damaging Het
D13Ertd608e A T 13: 119,842,688 probably null Het
Dmxl2 A T 9: 54,457,794 I138K unknown Het
Eapp A G 12: 54,673,723 S236P probably benign Het
Efnb3 T C 11: 69,557,220 H132R possibly damaging Het
Fbn2 A T 18: 58,105,136 N596K probably damaging Het
Fzd9 A G 5: 135,250,630 W134R probably damaging Het
Gga2 A G 7: 122,003,934 S180P probably damaging Het
Gm11639 T A 11: 105,036,799 M4798K probably benign Het
Gm30302 G T 13: 49,786,975 Q420K probably benign Het
Golga3 A G 5: 110,205,828 T911A probably benign Het
Gstm1 C T 3: 108,014,550 probably null Het
Heg1 A G 16: 33,727,497 T909A probably damaging Het
Herc2 T C 7: 56,157,438 S2455P probably benign Het
Herc2 C T 7: 56,220,525 R4349W probably damaging Het
Hivep2 T G 10: 14,143,851 M2122R possibly damaging Het
Itga10 T A 3: 96,657,391 probably null Het
Kbtbd13 G T 9: 65,391,323 C110* probably null Het
Krt78 T C 15: 101,950,883 E293G probably damaging Het
Lgals3bp C T 11: 118,398,169 V110M possibly damaging Het
Lrp2 A G 2: 69,477,008 probably null Het
Lrrc71 C A 3: 87,741,806 G352W probably damaging Het
Map3k9 A G 12: 81,724,732 V694A probably benign Het
Mboat2 T C 12: 24,939,326 S162P probably damaging Het
Megf11 C A 9: 64,679,253 N422K probably damaging Het
Miga1 C T 3: 152,276,687 S584N probably benign Het
Mindy2 A G 9: 70,616,859 Y403H probably damaging Het
Mmd C T 11: 90,276,757 A204V possibly damaging Het
Mta3 A T 17: 83,800,143 Y262F probably benign Het
Ncoa7 G A 10: 30,722,798 S43F probably benign Het
Nphp4 T C 4: 152,554,534 V874A probably benign Het
Nsd1 A G 13: 55,312,328 T2226A probably benign Het
Nt5dc1 T C 10: 34,314,796 H302R probably benign Het
Odc1 A G 12: 17,550,002 Y389C probably damaging Het
Olfr175-ps1 G A 16: 58,824,595 T38I probably damaging Het
Olfr551 A G 7: 102,587,918 I275T probably damaging Het
Olfr970 T G 9: 39,819,893 F85V probably damaging Het
Pcdhb10 A C 18: 37,412,312 Q147P probably benign Het
Pdcl2 A C 5: 76,317,828 C182G probably damaging Het
Pigv T C 4: 133,665,451 D136G possibly damaging Het
Pramel5 T C 4: 144,271,440 E411G possibly damaging Het
Prkce T C 17: 86,168,600 V3A probably benign Het
Pth1r T C 9: 110,722,393 N546S probably benign Het
Qrich2 C T 11: 116,455,322 V1559I probably benign Het
Rbm20 A C 19: 53,814,333 D424A possibly damaging Het
Rbm26 C T 14: 105,150,848 D393N probably damaging Het
Sf3b3 G A 8: 110,820,813 R728C probably damaging Het
Srcap A G 7: 127,538,748 N1090S probably benign Het
Syt4 A T 18: 31,443,822 S160T probably benign Het
Tfap2e C T 4: 126,721,934 V236M probably damaging Het
Thsd4 G A 9: 60,394,472 T180M probably damaging Het
Tlr4 T A 4: 66,840,206 M412K probably damaging Het
Tmem67 T A 4: 12,079,883 H136L probably benign Het
Tnpo2 T A 8: 85,044,415 I110N probably benign Het
Trav13d-3 A G 14: 53,033,413 M111V probably benign Het
Tubb3 A T 8: 123,421,161 S278C probably benign Het
Ugcg T A 4: 59,220,299 F364Y probably benign Het
Usp17lc T C 7: 103,418,499 S334P probably damaging Het
Vps13c A G 9: 67,945,509 D2357G probably damaging Het
Zfp157 T C 5: 138,455,910 Y125H probably benign Het
Zfp747 A T 7: 127,374,647 M117K probably benign Het
Znrd1 A C 17: 36,957,830 probably null Het
Zscan4c A T 7: 11,009,731 N419I possibly damaging Het
Other mutations in Lrrc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02017:Lrrc14 APN 15 76713742 missense probably damaging 0.99
IGL03213:Lrrc14 APN 15 76713783 missense possibly damaging 0.95
Sojourn UTSW 15 76713446 missense possibly damaging 0.91
Sumo UTSW 15 76713565 missense probably benign 0.17
R0302:Lrrc14 UTSW 15 76714352 missense probably benign 0.28
R2417:Lrrc14 UTSW 15 76713421 missense probably damaging 1.00
R3423:Lrrc14 UTSW 15 76713118 splice site probably null
R3930:Lrrc14 UTSW 15 76713565 missense probably benign 0.17
R3931:Lrrc14 UTSW 15 76713565 missense probably benign 0.17
R4622:Lrrc14 UTSW 15 76716340 unclassified probably benign
R4863:Lrrc14 UTSW 15 76713362 splice site probably null
R5290:Lrrc14 UTSW 15 76713943 missense probably benign 0.17
R5451:Lrrc14 UTSW 15 76713973 missense probably benign 0.01
R5950:Lrrc14 UTSW 15 76715310 unclassified probably benign
R6561:Lrrc14 UTSW 15 76713446 missense possibly damaging 0.91
R6609:Lrrc14 UTSW 15 76714253 missense probably benign
R7341:Lrrc14 UTSW 15 76714511 missense probably damaging 1.00
R8046:Lrrc14 UTSW 15 76714531 missense possibly damaging 0.78
R8223:Lrrc14 UTSW 15 76714556 missense probably damaging 1.00
R8393:Lrrc14 UTSW 15 76714198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATAACCTGGGCTTGCGTGG -3'
(R):5'- AGAACTCTGAGCCAGGAAGC -3'

Sequencing Primer
(F):5'- GCGTGGCCTGTCTGTCATTATC -3'
(R):5'- CAGGAAGCGTAGGTCCTCAG -3'
Posted On2019-10-24