Incidental Mutation 'R7638:Pcare'
ID 590104
Institutional Source Beutler Lab
Gene Symbol Pcare
Ensembl Gene ENSMUSG00000044375
Gene Name photoreceptor cilium actin regulator
Synonyms BC027072
MMRRC Submission 045696-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R7638 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 72050919-72059904 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72057880 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 599 (D599G)
Ref Sequence ENSEMBL: ENSMUSP00000051871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057405]
AlphaFold Q6PAC4
Predicted Effect probably damaging
Transcript: ENSMUST00000057405
AA Change: D599G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051871
Gene: ENSMUSG00000044375
AA Change: D599G

DomainStartEndE-ValueType
Pfam:Retinal 1 1255 N/A PFAM
Meta Mutation Damage Score 0.1015 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly expressed in photoreceptors and may associate with the primary cilium of the outer segment. The encoded protein appears to undergo post-translational lipid modification. Nonsense and missense variants of this gene appear to cause a recessive form of retinitis pigmentosa. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele develop severe early-onset retinal degeneration associated with a disorganized outer segment, progressive thinning of the outer nuclear layer, microglia activation, decreased a- and b-wave amplitudes, and nearly undetectable ERG responses by 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abo T G 2: 26,733,855 (GRCm39) T115P probably damaging Het
Aggf1 G A 13: 95,492,921 (GRCm39) R563* probably null Het
Amdhd1 A T 10: 93,370,360 (GRCm39) Y159* probably null Het
Camp T C 9: 109,677,461 (GRCm39) E124G Het
Casq2 A G 3: 101,994,016 (GRCm39) E21G possibly damaging Het
Cbln1 A T 8: 88,198,357 (GRCm39) F116Y probably damaging Het
Cklf A T 8: 104,989,996 (GRCm39) K143* probably null Het
Clca3a1 A G 3: 144,457,723 (GRCm39) I387T probably damaging Het
Cndp1 T A 18: 84,654,174 (GRCm39) D130V probably benign Het
Cyp4a12a T A 4: 115,184,670 (GRCm39) M317K possibly damaging Het
Dmxl2 A T 9: 54,365,078 (GRCm39) I138K unknown Het
Eapp A G 12: 54,720,508 (GRCm39) S236P probably benign Het
Efcab3 T A 11: 104,927,625 (GRCm39) M4798K probably benign Het
Efnb3 T C 11: 69,448,046 (GRCm39) H132R possibly damaging Het
Fam243 A G 16: 92,117,805 (GRCm39) V161A probably damaging Het
Fbn2 A T 18: 58,238,208 (GRCm39) N596K probably damaging Het
Fzd9 A G 5: 135,279,484 (GRCm39) W134R probably damaging Het
Gga2 A G 7: 121,603,157 (GRCm39) S180P probably damaging Het
Golga3 A G 5: 110,353,694 (GRCm39) T911A probably benign Het
Gstm1 C T 3: 107,921,866 (GRCm39) probably null Het
Heg1 A G 16: 33,547,867 (GRCm39) T909A probably damaging Het
Herc2 T C 7: 55,807,186 (GRCm39) S2455P probably benign Het
Herc2 C T 7: 55,870,273 (GRCm39) R4349W probably damaging Het
Hivep2 T G 10: 14,019,595 (GRCm39) M2122R possibly damaging Het
Itga10 T A 3: 96,564,707 (GRCm39) probably null Het
Kbtbd13 G T 9: 65,298,605 (GRCm39) C110* probably null Het
Krt78 T C 15: 101,859,318 (GRCm39) E293G probably damaging Het
Lgals3bp C T 11: 118,288,995 (GRCm39) V110M possibly damaging Het
Lrp2 A G 2: 69,307,352 (GRCm39) probably null Het
Lrrc14 A G 15: 76,598,173 (GRCm39) D301G probably benign Het
Lrrc71 C A 3: 87,649,113 (GRCm39) G352W probably damaging Het
Map3k9 A G 12: 81,771,506 (GRCm39) V694A probably benign Het
Mboat2 T C 12: 24,989,325 (GRCm39) S162P probably damaging Het
Megf11 C A 9: 64,586,535 (GRCm39) N422K probably damaging Het
Miga1 C T 3: 151,982,324 (GRCm39) S584N probably benign Het
Mindy2 A G 9: 70,524,141 (GRCm39) Y403H probably damaging Het
Mmd C T 11: 90,167,583 (GRCm39) A204V possibly damaging Het
Mta3 A T 17: 84,107,572 (GRCm39) Y262F probably benign Het
Ncoa7 G A 10: 30,598,794 (GRCm39) S43F probably benign Het
Nhsl3 T C 4: 129,115,734 (GRCm39) T1022A probably benign Het
Nphp4 T C 4: 152,638,991 (GRCm39) V874A probably benign Het
Nsd1 A G 13: 55,460,141 (GRCm39) T2226A probably benign Het
Nt5dc1 T C 10: 34,190,792 (GRCm39) H302R probably benign Het
Odc1 A G 12: 17,600,003 (GRCm39) Y389C probably damaging Het
Or52p2 A G 7: 102,237,125 (GRCm39) I275T probably damaging Het
Or5k8 G A 16: 58,644,958 (GRCm39) T38I probably damaging Het
Or8g37 T G 9: 39,731,189 (GRCm39) F85V probably damaging Het
Pcdhb10 A C 18: 37,545,365 (GRCm39) Q147P probably benign Het
Pdcl2 A C 5: 76,465,675 (GRCm39) C182G probably damaging Het
Pigv T C 4: 133,392,762 (GRCm39) D136G possibly damaging Het
Polr1h A C 17: 37,268,722 (GRCm39) probably null Het
Pramel5 T C 4: 143,998,010 (GRCm39) E411G possibly damaging Het
Prkce T C 17: 86,476,028 (GRCm39) V3A probably benign Het
Pth1r T C 9: 110,551,461 (GRCm39) N546S probably benign Het
Qrich2 C T 11: 116,346,148 (GRCm39) V1559I probably benign Het
Rbm20 A C 19: 53,802,764 (GRCm39) D424A possibly damaging Het
Rbm26 C T 14: 105,388,284 (GRCm39) D393N probably damaging Het
Sf3b3 G A 8: 111,547,445 (GRCm39) R728C probably damaging Het
Spata31e1 G T 13: 49,940,451 (GRCm39) Q420K probably benign Het
Srcap A G 7: 127,137,920 (GRCm39) N1090S probably benign Het
Syt4 A T 18: 31,576,875 (GRCm39) S160T probably benign Het
Tcstv6 A T 13: 120,304,224 (GRCm39) probably null Het
Tfap2e C T 4: 126,615,727 (GRCm39) V236M probably damaging Het
Thsd4 G A 9: 60,301,755 (GRCm39) T180M probably damaging Het
Tlr4 T A 4: 66,758,443 (GRCm39) M412K probably damaging Het
Tmem67 T A 4: 12,079,883 (GRCm39) H136L probably benign Het
Tnpo2 T A 8: 85,771,044 (GRCm39) I110N probably benign Het
Trav13d-3 A G 14: 53,270,870 (GRCm39) M111V probably benign Het
Tubb3 A T 8: 124,147,900 (GRCm39) S278C probably benign Het
Ugcg T A 4: 59,220,299 (GRCm39) F364Y probably benign Het
Usp17lc T C 7: 103,067,706 (GRCm39) S334P probably damaging Het
Vps13c A G 9: 67,852,791 (GRCm39) D2357G probably damaging Het
Zfp157 T C 5: 138,454,172 (GRCm39) Y125H probably benign Het
Zfp747 A T 7: 126,973,819 (GRCm39) M117K probably benign Het
Zscan4c A T 7: 10,743,658 (GRCm39) N419I possibly damaging Het
Other mutations in Pcare
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02010:Pcare APN 17 72,056,459 (GRCm39) missense probably benign 0.38
IGL02033:Pcare APN 17 72,058,076 (GRCm39) missense probably damaging 1.00
IGL02711:Pcare APN 17 72,056,377 (GRCm39) missense probably benign 0.15
IGL03185:Pcare APN 17 72,056,332 (GRCm39) missense probably damaging 0.98
IGL03242:Pcare APN 17 72,057,266 (GRCm39) missense probably benign 0.01
R0367:Pcare UTSW 17 72,057,471 (GRCm39) missense probably damaging 1.00
R0413:Pcare UTSW 17 72,059,212 (GRCm39) missense probably benign 0.38
R0465:Pcare UTSW 17 72,057,155 (GRCm39) missense probably benign 0.42
R0535:Pcare UTSW 17 72,059,434 (GRCm39) missense probably benign 0.01
R0681:Pcare UTSW 17 72,056,509 (GRCm39) missense probably benign 0.00
R0736:Pcare UTSW 17 72,051,659 (GRCm39) missense probably benign 0.00
R1406:Pcare UTSW 17 72,056,156 (GRCm39) missense probably benign 0.18
R1406:Pcare UTSW 17 72,056,156 (GRCm39) missense probably benign 0.18
R1530:Pcare UTSW 17 72,056,473 (GRCm39) missense probably benign 0.01
R1723:Pcare UTSW 17 72,057,373 (GRCm39) missense probably damaging 1.00
R1941:Pcare UTSW 17 72,059,063 (GRCm39) missense probably damaging 1.00
R2179:Pcare UTSW 17 72,059,521 (GRCm39) missense probably damaging 1.00
R2232:Pcare UTSW 17 72,056,279 (GRCm39) missense probably benign 0.00
R2519:Pcare UTSW 17 72,058,642 (GRCm39) missense probably damaging 1.00
R2997:Pcare UTSW 17 72,051,706 (GRCm39) critical splice acceptor site probably benign
R3899:Pcare UTSW 17 72,057,155 (GRCm39) missense probably benign 0.00
R4890:Pcare UTSW 17 72,059,306 (GRCm39) missense possibly damaging 0.50
R4898:Pcare UTSW 17 72,058,066 (GRCm39) missense probably damaging 1.00
R5347:Pcare UTSW 17 72,056,930 (GRCm39) missense probably benign 0.00
R5436:Pcare UTSW 17 72,057,837 (GRCm39) missense probably damaging 1.00
R5527:Pcare UTSW 17 72,059,635 (GRCm39) missense probably damaging 1.00
R5556:Pcare UTSW 17 72,059,420 (GRCm39) missense possibly damaging 0.81
R5625:Pcare UTSW 17 72,058,321 (GRCm39) missense probably damaging 1.00
R5707:Pcare UTSW 17 72,058,567 (GRCm39) missense possibly damaging 0.90
R5932:Pcare UTSW 17 72,058,748 (GRCm39) missense probably damaging 1.00
R6043:Pcare UTSW 17 72,057,037 (GRCm39) missense probably damaging 1.00
R6314:Pcare UTSW 17 72,059,452 (GRCm39) missense probably benign 0.04
R6513:Pcare UTSW 17 72,051,701 (GRCm39) missense probably damaging 1.00
R7575:Pcare UTSW 17 72,057,850 (GRCm39) missense probably damaging 1.00
R7848:Pcare UTSW 17 72,056,188 (GRCm39) missense probably benign 0.04
R8317:Pcare UTSW 17 72,056,197 (GRCm39) missense probably benign 0.10
R8530:Pcare UTSW 17 72,059,101 (GRCm39) missense probably damaging 1.00
R8671:Pcare UTSW 17 72,058,372 (GRCm39) missense probably benign 0.34
R8831:Pcare UTSW 17 72,059,305 (GRCm39) missense probably benign 0.01
R8854:Pcare UTSW 17 72,056,326 (GRCm39) missense probably benign
R8941:Pcare UTSW 17 72,059,137 (GRCm39) missense probably benign 0.06
R9227:Pcare UTSW 17 72,057,217 (GRCm39) missense probably damaging 1.00
R9230:Pcare UTSW 17 72,057,217 (GRCm39) missense probably damaging 1.00
R9380:Pcare UTSW 17 72,056,351 (GRCm39) missense possibly damaging 0.95
R9390:Pcare UTSW 17 72,057,983 (GRCm39) missense probably benign 0.09
R9618:Pcare UTSW 17 72,057,817 (GRCm39) missense probably damaging 1.00
X0035:Pcare UTSW 17 72,051,706 (GRCm39) critical splice acceptor site probably benign
Z1177:Pcare UTSW 17 72,057,398 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCCTTGAACTTGCTGATG -3'
(R):5'- CCAGGCCCAGGAAATGATTCTG -3'

Sequencing Primer
(F):5'- TGATGGCACTACTGGGACTCAC -3'
(R):5'- TTCTGAAGATGAAAGAGGCCATC -3'
Posted On 2019-10-24