Incidental Mutation 'R7638:Prkce'
ID590106
Institutional Source Beutler Lab
Gene Symbol Prkce
Ensembl Gene ENSMUSG00000045038
Gene Nameprotein kinase C, epsilon
SynonymsPkce, PKCepsilon, PKC[e], 5830406C15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7638 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location86167785-86657919 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86168600 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 3 (V3A)
Ref Sequence ENSEMBL: ENSMUSP00000094873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097274] [ENSMUST00000097275] [ENSMUST00000142003]
Predicted Effect probably benign
Transcript: ENSMUST00000097274
AA Change: V3A

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000094873
Gene: ENSMUSG00000045038
AA Change: V3A

DomainStartEndE-ValueType
C2 7 114 5.78e-12 SMART
C1 170 220 4.48e-13 SMART
C1 243 292 8.29e-17 SMART
S_TKc 408 668 1.3e-104 SMART
S_TK_X 669 732 2.56e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097275
AA Change: V3A

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000094874
Gene: ENSMUSG00000045038
AA Change: V3A

DomainStartEndE-ValueType
C2 7 114 5.78e-12 SMART
C1 170 220 4.48e-13 SMART
C1 243 292 8.29e-17 SMART
S_TKc 408 668 1.3e-104 SMART
S_TK_X 669 732 2.56e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142003
AA Change: V3A

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138615
Gene: ENSMUSG00000045038
AA Change: V3A

DomainStartEndE-ValueType
C2 7 114 5.78e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been shown to be involved in many different cellular functions, such as neuron channel activation, apoptosis, cardioprotection from ischemia, heat shock response, as well as insulin exocytosis. Knockout studies in mice suggest that this kinase is important for lipopolysaccharide (LPS)-mediated signaling in activated macrophages and may also play a role in controlling anxiety-like behavior. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced ethanol self-administration and are more sensitive to the acute behavioral effects of ethanol and other drugs that activate GABA(A) receptors. Mutants show reduced anxiety and stress hormones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik A G 16: 92,320,917 V161A probably damaging Het
Abo T G 2: 26,843,843 T115P probably damaging Het
Aggf1 G A 13: 95,356,413 R563* probably null Het
Amdhd1 A T 10: 93,534,498 Y159* probably null Het
BC027072 T C 17: 71,750,885 D599G probably damaging Het
C77080 T C 4: 129,221,941 T1022A probably benign Het
Camp T C 9: 109,848,393 E124G Het
Casq2 A G 3: 102,086,700 E21G possibly damaging Het
Cbln1 A T 8: 87,471,729 F116Y probably damaging Het
Cklf A T 8: 104,263,364 K143* probably null Het
Clca3a1 A G 3: 144,751,962 I387T probably damaging Het
Cndp1 T A 18: 84,636,049 D130V probably benign Het
Cyp4a12a T A 4: 115,327,473 M317K possibly damaging Het
D13Ertd608e A T 13: 119,842,688 probably null Het
Dmxl2 A T 9: 54,457,794 I138K unknown Het
Eapp A G 12: 54,673,723 S236P probably benign Het
Efnb3 T C 11: 69,557,220 H132R possibly damaging Het
Fbn2 A T 18: 58,105,136 N596K probably damaging Het
Fzd9 A G 5: 135,250,630 W134R probably damaging Het
Gga2 A G 7: 122,003,934 S180P probably damaging Het
Gm11639 T A 11: 105,036,799 M4798K probably benign Het
Gm30302 G T 13: 49,786,975 Q420K probably benign Het
Golga3 A G 5: 110,205,828 T911A probably benign Het
Gstm1 C T 3: 108,014,550 probably null Het
Heg1 A G 16: 33,727,497 T909A probably damaging Het
Herc2 T C 7: 56,157,438 S2455P probably benign Het
Herc2 C T 7: 56,220,525 R4349W probably damaging Het
Hivep2 T G 10: 14,143,851 M2122R possibly damaging Het
Itga10 T A 3: 96,657,391 probably null Het
Kbtbd13 G T 9: 65,391,323 C110* probably null Het
Krt78 T C 15: 101,950,883 E293G probably damaging Het
Lgals3bp C T 11: 118,398,169 V110M possibly damaging Het
Lrp2 A G 2: 69,477,008 probably null Het
Lrrc14 A G 15: 76,713,973 D301G probably benign Het
Lrrc71 C A 3: 87,741,806 G352W probably damaging Het
Map3k9 A G 12: 81,724,732 V694A probably benign Het
Mboat2 T C 12: 24,939,326 S162P probably damaging Het
Megf11 C A 9: 64,679,253 N422K probably damaging Het
Miga1 C T 3: 152,276,687 S584N probably benign Het
Mindy2 A G 9: 70,616,859 Y403H probably damaging Het
Mmd C T 11: 90,276,757 A204V possibly damaging Het
Mta3 A T 17: 83,800,143 Y262F probably benign Het
Ncoa7 G A 10: 30,722,798 S43F probably benign Het
Nphp4 T C 4: 152,554,534 V874A probably benign Het
Nsd1 A G 13: 55,312,328 T2226A probably benign Het
Nt5dc1 T C 10: 34,314,796 H302R probably benign Het
Odc1 A G 12: 17,550,002 Y389C probably damaging Het
Olfr175-ps1 G A 16: 58,824,595 T38I probably damaging Het
Olfr551 A G 7: 102,587,918 I275T probably damaging Het
Olfr970 T G 9: 39,819,893 F85V probably damaging Het
Pcdhb10 A C 18: 37,412,312 Q147P probably benign Het
Pdcl2 A C 5: 76,317,828 C182G probably damaging Het
Pigv T C 4: 133,665,451 D136G possibly damaging Het
Pramel5 T C 4: 144,271,440 E411G possibly damaging Het
Pth1r T C 9: 110,722,393 N546S probably benign Het
Qrich2 C T 11: 116,455,322 V1559I probably benign Het
Rbm20 A C 19: 53,814,333 D424A possibly damaging Het
Rbm26 C T 14: 105,150,848 D393N probably damaging Het
Sf3b3 G A 8: 110,820,813 R728C probably damaging Het
Srcap A G 7: 127,538,748 N1090S probably benign Het
Syt4 A T 18: 31,443,822 S160T probably benign Het
Tfap2e C T 4: 126,721,934 V236M probably damaging Het
Thsd4 G A 9: 60,394,472 T180M probably damaging Het
Tlr4 T A 4: 66,840,206 M412K probably damaging Het
Tmem67 T A 4: 12,079,883 H136L probably benign Het
Tnpo2 T A 8: 85,044,415 I110N probably benign Het
Trav13d-3 A G 14: 53,033,413 M111V probably benign Het
Tubb3 A T 8: 123,421,161 S278C probably benign Het
Ugcg T A 4: 59,220,299 F364Y probably benign Het
Usp17lc T C 7: 103,418,499 S334P probably damaging Het
Vps13c A G 9: 67,945,509 D2357G probably damaging Het
Zfp157 T C 5: 138,455,910 Y125H probably benign Het
Zfp747 A T 7: 127,374,647 M117K probably benign Het
Znrd1 A C 17: 36,957,830 probably null Het
Zscan4c A T 7: 11,009,731 N419I possibly damaging Het
Other mutations in Prkce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Prkce APN 17 86625462 missense probably damaging 0.99
IGL01401:Prkce APN 17 86168840 missense probably damaging 1.00
IGL01508:Prkce APN 17 86630085 missense probably damaging 1.00
IGL02500:Prkce APN 17 86168914 missense probably benign 0.16
IGL02957:Prkce APN 17 86496026 missense possibly damaging 0.74
IGL03114:Prkce APN 17 86654555 missense probably damaging 0.97
Pinnacles UTSW 17 86476851 missense probably damaging 1.00
R0063:Prkce UTSW 17 86482111 splice site probably benign
R0063:Prkce UTSW 17 86482111 splice site probably benign
R0403:Prkce UTSW 17 86168653 missense probably damaging 0.98
R0900:Prkce UTSW 17 86625458 missense probably damaging 1.00
R0919:Prkce UTSW 17 86630160 missense probably benign 0.06
R1413:Prkce UTSW 17 86496018 missense possibly damaging 0.81
R1430:Prkce UTSW 17 86559137 splice site probably benign
R1843:Prkce UTSW 17 86475546 nonsense probably null
R2129:Prkce UTSW 17 86496035 missense possibly damaging 0.89
R2341:Prkce UTSW 17 86474442 missense probably damaging 1.00
R2511:Prkce UTSW 17 86625326 missense probably damaging 1.00
R2679:Prkce UTSW 17 86176226 intron probably benign
R3724:Prkce UTSW 17 86168623 nonsense probably null
R3853:Prkce UTSW 17 86168849 missense probably damaging 1.00
R4364:Prkce UTSW 17 86476851 missense probably damaging 1.00
R4467:Prkce UTSW 17 86619911 missense possibly damaging 0.68
R4523:Prkce UTSW 17 86490750 critical splice acceptor site probably null
R4838:Prkce UTSW 17 86630083 missense probably benign 0.07
R5140:Prkce UTSW 17 86482142 missense probably benign 0.12
R5579:Prkce UTSW 17 86619948 missense probably damaging 1.00
R6026:Prkce UTSW 17 86493230 missense probably benign 0.02
R6048:Prkce UTSW 17 86493347 missense probably benign
R6212:Prkce UTSW 17 86559301 missense probably damaging 1.00
R6484:Prkce UTSW 17 86490809 missense probably benign
R6788:Prkce UTSW 17 86630061 missense probably damaging 1.00
R6915:Prkce UTSW 17 86493407 missense probably damaging 1.00
R7349:Prkce UTSW 17 86493355 missense probably benign
R7447:Prkce UTSW 17 86559259 missense probably damaging 1.00
R7566:Prkce UTSW 17 86493329 missense probably benign 0.00
R7577:Prkce UTSW 17 86493293 nonsense probably null
R8237:Prkce UTSW 17 86559218 missense probably damaging 1.00
RF010:Prkce UTSW 17 86488199 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CATGCACTCGCTGAGAATCG -3'
(R):5'- AAGACAGCCAGCTCGATCTTG -3'

Sequencing Primer
(F):5'- CTGAGAATCGGCGGCGC -3'
(R):5'- AACTCATCGTGCCAGGC -3'
Posted On2019-10-24