Incidental Mutation 'R7639:Nat10'
ID590118
Institutional Source Beutler Lab
Gene Symbol Nat10
Ensembl Gene ENSMUSG00000027185
Gene NameN-acetyltransferase 10
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7639 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location103721256-103761270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103743090 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 354 (A354V)
Ref Sequence ENSEMBL: ENSMUSP00000028608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028608]
Predicted Effect probably damaging
Transcript: ENSMUST00000028608
AA Change: A354V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028608
Gene: ENSMUSG00000027185
AA Change: A354V

DomainStartEndE-ValueType
Pfam:DUF1726 107 201 6.9e-39 PFAM
low complexity region 226 242 N/A INTRINSIC
Pfam:Helicase_RecD 281 488 1.3e-68 PFAM
Pfam:GNAT_acetyltr_2 528 753 7e-103 PFAM
Pfam:tRNA_bind_2 771 892 3.6e-46 PFAM
low complexity region 999 1024 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA cytidine acetyltransferase involved in histone acetylation, tRNA acetylation, the biosynthesis of 18S rRNA, and the enhancement of nuclear architecture and chromatin organization. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T A 17: 84,670,103 M381L probably benign Het
Abl1 T A 2: 31,779,161 L184Q probably damaging Het
Atp8b1 A G 18: 64,564,543 V410A possibly damaging Het
Bhmt2 C T 13: 93,663,314 G205R probably damaging Het
Bicd1 A G 6: 149,513,004 D405G possibly damaging Het
Brip1 A T 11: 86,152,822 probably null Het
Ccdc180 A T 4: 45,928,043 I1193F possibly damaging Het
Cdc14b A G 13: 64,205,329 C478R possibly damaging Het
Celsr1 C T 15: 85,929,872 E1950K probably benign Het
Cnot7 A G 8: 40,507,453 probably null Het
Defa34 A T 8: 21,665,867 K24I probably benign Het
Dsg4 G T 18: 20,449,712 D136Y probably damaging Het
Dync2h1 C A 9: 7,141,254 V1258F probably damaging Het
Erbb3 A G 10: 128,569,847 S1181P probably damaging Het
Evl A G 12: 108,686,103 D366G probably damaging Het
Fam234b A T 6: 135,225,800 probably null Het
Fanca A G 8: 123,291,395 probably null Het
Fbxo46 T A 7: 19,136,635 V393E probably damaging Het
Gkap1 T G 13: 58,263,970 K63T probably damaging Het
Hfm1 T A 5: 106,889,925 D742V probably benign Het
Hfm1 A G 5: 106,898,475 V515A possibly damaging Het
Itga10 G A 3: 96,649,582 V207I probably benign Het
Lipi T A 16: 75,560,855 Y274F probably benign Het
Mettl8 A T 2: 70,982,182 S36R probably benign Het
Miip A T 4: 147,862,564 M244K probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Nav1 T C 1: 135,471,122 N574S probably benign Het
Nlrc4 C T 17: 74,447,957 probably null Het
Oas2 C T 5: 120,745,686 W244* probably null Het
Oat A T 7: 132,566,801 I163N probably damaging Het
Olfr57 A G 10: 79,035,372 D192G probably damaging Het
Otop3 T C 11: 115,344,361 M273T possibly damaging Het
Poln A C 5: 34,133,151 V60G possibly damaging Het
Ppp1r13b G T 12: 111,833,615 A699E probably damaging Het
Rims1 A T 1: 22,805,669 M19K probably benign Het
Rnf145 T C 11: 44,531,357 L89P probably damaging Het
Rock1 A G 18: 10,140,244 S116P probably damaging Het
Rtn3 C T 19: 7,457,991 C212Y probably benign Het
Smcp G A 3: 92,584,490 P17S unknown Het
Syne2 A C 12: 75,934,499 E1525A probably damaging Het
Tpra1 A G 6: 88,910,176 D172G probably benign Het
Traf2 TAGA TA 2: 25,537,088 probably null Het
Trpa1 T C 1: 14,886,913 T760A probably benign Het
Unc13c T A 9: 73,933,168 S134C probably damaging Het
Zfp729b C T 13: 67,591,852 V765I probably benign Het
Other mutations in Nat10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Nat10 APN 2 103725764 critical splice acceptor site probably null
IGL01062:Nat10 APN 2 103743048 missense probably damaging 1.00
IGL01524:Nat10 APN 2 103757757 missense probably damaging 1.00
IGL02553:Nat10 APN 2 103752668 missense probably damaging 1.00
IGL03040:Nat10 APN 2 103757265 splice site probably benign
R0106:Nat10 UTSW 2 103757205 missense probably damaging 1.00
R0106:Nat10 UTSW 2 103757205 missense probably damaging 1.00
R0268:Nat10 UTSW 2 103727917 splice site probably benign
R0422:Nat10 UTSW 2 103726729 nonsense probably null
R0423:Nat10 UTSW 2 103748227 missense probably damaging 0.98
R0788:Nat10 UTSW 2 103743115 missense probably damaging 1.00
R0946:Nat10 UTSW 2 103731374 missense probably damaging 0.99
R1353:Nat10 UTSW 2 103754073 missense possibly damaging 0.95
R2141:Nat10 UTSW 2 103731303 splice site probably null
R2142:Nat10 UTSW 2 103731303 splice site probably null
R2192:Nat10 UTSW 2 103726177 missense probably benign 0.00
R3904:Nat10 UTSW 2 103726247 splice site probably benign
R4183:Nat10 UTSW 2 103739813 missense probably damaging 1.00
R4496:Nat10 UTSW 2 103757739 missense probably damaging 1.00
R4578:Nat10 UTSW 2 103754072 missense probably damaging 1.00
R4589:Nat10 UTSW 2 103754070 missense probably damaging 1.00
R4639:Nat10 UTSW 2 103734889 missense probably benign 0.00
R4679:Nat10 UTSW 2 103732170 missense probably damaging 1.00
R4711:Nat10 UTSW 2 103748267 nonsense probably null
R5089:Nat10 UTSW 2 103757143 unclassified probably benign
R5103:Nat10 UTSW 2 103757260 missense probably damaging 0.97
R5108:Nat10 UTSW 2 103732203 missense probably damaging 0.97
R5134:Nat10 UTSW 2 103743293 missense probably benign 0.29
R5823:Nat10 UTSW 2 103730267 missense probably damaging 1.00
R5893:Nat10 UTSW 2 103721839 unclassified probably benign
R6135:Nat10 UTSW 2 103743316 missense probably damaging 1.00
R6455:Nat10 UTSW 2 103739886 missense possibly damaging 0.69
R6592:Nat10 UTSW 2 103754150 missense probably null 1.00
R6956:Nat10 UTSW 2 103734412 missense probably benign 0.01
R7036:Nat10 UTSW 2 103754108 missense probably benign 0.00
R7063:Nat10 UTSW 2 103748077 missense probably benign 0.01
R7172:Nat10 UTSW 2 103732969 missense probably damaging 1.00
R7226:Nat10 UTSW 2 103726753 missense probably benign 0.01
R7286:Nat10 UTSW 2 103754169 missense probably benign 0.02
R7448:Nat10 UTSW 2 103748045 missense probably damaging 0.99
R7470:Nat10 UTSW 2 103734881 missense probably benign 0.00
R7640:Nat10 UTSW 2 103743090 missense probably damaging 1.00
R7641:Nat10 UTSW 2 103743090 missense probably damaging 1.00
R7642:Nat10 UTSW 2 103726786 missense possibly damaging 0.94
R7766:Nat10 UTSW 2 103725707 missense probably benign 0.00
R7787:Nat10 UTSW 2 103721863 missense unknown
R7910:Nat10 UTSW 2 103725145 missense probably benign 0.26
R7991:Nat10 UTSW 2 103725145 missense probably benign 0.26
X0024:Nat10 UTSW 2 103727881 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AATGCCATCCTCACTTGGTG -3'
(R):5'- ATGCTCTGCAGTATCAGGTAAG -3'

Sequencing Primer
(F):5'- CACTTGGTGCTGATAATCTGC -3'
(R):5'- CTCTGCAGTATCAGGTAAGAAAGTC -3'
Posted On2019-10-24