Incidental Mutation 'R7639:Itga10'
ID590120
Institutional Source Beutler Lab
Gene Symbol Itga10
Ensembl Gene ENSMUSG00000090210
Gene Nameintegrin, alpha 10
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R7639 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location96645584-96664519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 96649582 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 207 (V207I)
Ref Sequence ENSEMBL: ENSMUSP00000112393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000048766] [ENSMUST00000118557] [ENSMUST00000119365] [ENSMUST00000137564] [ENSMUST00000165842]
Predicted Effect probably benign
Transcript: ENSMUST00000029744
AA Change: V207I

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210
AA Change: V207I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1123 1145 N/A INTRINSIC
low complexity region 1153 1166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048766
SMART Domains Protein: ENSMUSP00000037962
Gene: ENSMUSG00000028102

DomainStartEndE-ValueType
Pfam:PEX11 1 251 1.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118557
SMART Domains Protein: ENSMUSP00000113365
Gene: ENSMUSG00000028102

DomainStartEndE-ValueType
Pfam:PEX11 1 251 8.3e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119365
AA Change: V207I

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210
AA Change: V207I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Int_alpha 37 93 9.03e-3 SMART
VWA 165 355 9.6e-43 SMART
Int_alpha 427 481 2.01e0 SMART
Int_alpha 482 539 5.14e-7 SMART
Int_alpha 545 600 5.34e-14 SMART
Int_alpha 607 652 8.75e0 SMART
transmembrane domain 1122 1144 N/A INTRINSIC
low complexity region 1152 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137564
SMART Domains Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

DomainStartEndE-ValueType
Pfam:PEX11 1 172 4.5e-57 PFAM
low complexity region 186 204 N/A INTRINSIC
Int_alpha 222 278 9.03e-3 SMART
Blast:VWA 292 345 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000165842
SMART Domains Protein: ENSMUSP00000126631
Gene: ENSMUSG00000028102

DomainStartEndE-ValueType
Pfam:PEX11 3 237 8.9e-69 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T A 17: 84,670,103 M381L probably benign Het
Abl1 T A 2: 31,779,161 L184Q probably damaging Het
Atp8b1 A G 18: 64,564,543 V410A possibly damaging Het
Bhmt2 C T 13: 93,663,314 G205R probably damaging Het
Bicd1 A G 6: 149,513,004 D405G possibly damaging Het
Brip1 A T 11: 86,152,822 probably null Het
Ccdc180 A T 4: 45,928,043 I1193F possibly damaging Het
Cdc14b A G 13: 64,205,329 C478R possibly damaging Het
Celsr1 C T 15: 85,929,872 E1950K probably benign Het
Cnot7 A G 8: 40,507,453 probably null Het
Defa34 A T 8: 21,665,867 K24I probably benign Het
Dsg4 G T 18: 20,449,712 D136Y probably damaging Het
Dync2h1 C A 9: 7,141,254 V1258F probably damaging Het
Erbb3 A G 10: 128,569,847 S1181P probably damaging Het
Evl A G 12: 108,686,103 D366G probably damaging Het
Fam234b A T 6: 135,225,800 probably null Het
Fanca A G 8: 123,291,395 probably null Het
Fbxo46 T A 7: 19,136,635 V393E probably damaging Het
Gkap1 T G 13: 58,263,970 K63T probably damaging Het
Hfm1 T A 5: 106,889,925 D742V probably benign Het
Hfm1 A G 5: 106,898,475 V515A possibly damaging Het
Lipi T A 16: 75,560,855 Y274F probably benign Het
Mettl8 A T 2: 70,982,182 S36R probably benign Het
Miip A T 4: 147,862,564 M244K probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Nav1 T C 1: 135,471,122 N574S probably benign Het
Nlrc4 C T 17: 74,447,957 probably null Het
Oas2 C T 5: 120,745,686 W244* probably null Het
Oat A T 7: 132,566,801 I163N probably damaging Het
Olfr57 A G 10: 79,035,372 D192G probably damaging Het
Otop3 T C 11: 115,344,361 M273T possibly damaging Het
Poln A C 5: 34,133,151 V60G possibly damaging Het
Ppp1r13b G T 12: 111,833,615 A699E probably damaging Het
Rims1 A T 1: 22,805,669 M19K probably benign Het
Rnf145 T C 11: 44,531,357 L89P probably damaging Het
Rock1 A G 18: 10,140,244 S116P probably damaging Het
Rtn3 C T 19: 7,457,991 C212Y probably benign Het
Smcp G A 3: 92,584,490 P17S unknown Het
Syne2 A C 12: 75,934,499 E1525A probably damaging Het
Tpra1 A G 6: 88,910,176 D172G probably benign Het
Traf2 TAGA TA 2: 25,537,088 probably null Het
Trpa1 T C 1: 14,886,913 T760A probably benign Het
Unc13c T A 9: 73,933,168 S134C probably damaging Het
Zfp729b C T 13: 67,591,852 V765I probably benign Het
Other mutations in Itga10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Itga10 APN 3 96647641 missense probably damaging 0.96
IGL01694:Itga10 APN 3 96652517 missense probably damaging 0.99
IGL01754:Itga10 APN 3 96656775 unclassified probably benign
IGL02527:Itga10 APN 3 96655624 unclassified probably benign
IGL02956:Itga10 APN 3 96655113 missense possibly damaging 0.46
IGL03371:Itga10 APN 3 96654788 missense possibly damaging 0.84
IGL03055:Itga10 UTSW 3 96650520 missense probably damaging 0.99
PIT4515001:Itga10 UTSW 3 96662632 missense probably damaging 0.99
R0153:Itga10 UTSW 3 96653700 missense probably benign 0.00
R0308:Itga10 UTSW 3 96651464 missense probably damaging 1.00
R0331:Itga10 UTSW 3 96652483 missense probably damaging 1.00
R0413:Itga10 UTSW 3 96649059 missense probably damaging 1.00
R0437:Itga10 UTSW 3 96649137 missense probably damaging 1.00
R0511:Itga10 UTSW 3 96658174 missense probably damaging 1.00
R0630:Itga10 UTSW 3 96656299 unclassified probably benign
R0844:Itga10 UTSW 3 96651738 splice site probably benign
R0849:Itga10 UTSW 3 96652530 missense possibly damaging 0.67
R0894:Itga10 UTSW 3 96653660 missense possibly damaging 0.69
R0919:Itga10 UTSW 3 96651738 splice site probably benign
R1027:Itga10 UTSW 3 96651738 splice site probably benign
R1341:Itga10 UTSW 3 96652495 missense probably damaging 1.00
R1350:Itga10 UTSW 3 96657477 missense probably benign 0.01
R1370:Itga10 UTSW 3 96651738 splice site probably benign
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1467:Itga10 UTSW 3 96652229 nonsense probably null
R1589:Itga10 UTSW 3 96651738 splice site probably benign
R1590:Itga10 UTSW 3 96651738 splice site probably benign
R1601:Itga10 UTSW 3 96653658 missense possibly damaging 0.82
R1659:Itga10 UTSW 3 96662977 missense probably damaging 0.96
R1665:Itga10 UTSW 3 96651738 splice site probably benign
R1667:Itga10 UTSW 3 96651738 splice site probably benign
R1686:Itga10 UTSW 3 96651825 missense probably damaging 0.97
R1972:Itga10 UTSW 3 96651738 splice site probably benign
R1976:Itga10 UTSW 3 96651738 splice site probably benign
R2020:Itga10 UTSW 3 96652490 missense probably damaging 1.00
R2040:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96651738 splice site probably benign
R2044:Itga10 UTSW 3 96657690 missense probably benign
R2045:Itga10 UTSW 3 96651738 splice site probably benign
R2060:Itga10 UTSW 3 96654998 nonsense probably null
R2146:Itga10 UTSW 3 96651492 missense possibly damaging 0.59
R2146:Itga10 UTSW 3 96653723 missense probably damaging 1.00
R2170:Itga10 UTSW 3 96650457 missense probably damaging 1.00
R2893:Itga10 UTSW 3 96655100 missense probably benign 0.11
R2926:Itga10 UTSW 3 96652849 missense probably damaging 1.00
R3622:Itga10 UTSW 3 96651738 splice site probably benign
R3623:Itga10 UTSW 3 96651738 splice site probably benign
R4416:Itga10 UTSW 3 96658246 missense possibly damaging 0.58
R4633:Itga10 UTSW 3 96647704 missense possibly damaging 0.92
R5074:Itga10 UTSW 3 96652211 nonsense probably null
R5095:Itga10 UTSW 3 96648164 missense probably benign 0.21
R5495:Itga10 UTSW 3 96647371 missense possibly damaging 0.92
R5813:Itga10 UTSW 3 96652585 missense probably benign 0.38
R6114:Itga10 UTSW 3 96649035 missense probably damaging 1.00
R6172:Itga10 UTSW 3 96647437 missense probably benign 0.18
R6275:Itga10 UTSW 3 96658185 missense probably benign 0.36
R6298:Itga10 UTSW 3 96656762 missense probably benign 0.00
R6433:Itga10 UTSW 3 96658041 critical splice donor site probably null
R6841:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R6909:Itga10 UTSW 3 96662599 missense probably benign 0.00
R6927:Itga10 UTSW 3 96656714 missense probably damaging 1.00
R7124:Itga10 UTSW 3 96651765 missense probably damaging 0.96
R7310:Itga10 UTSW 3 96648159 missense probably damaging 1.00
R7387:Itga10 UTSW 3 96652778 missense probably benign 0.11
R7464:Itga10 UTSW 3 96648155 missense probably damaging 1.00
R7624:Itga10 UTSW 3 96652953 missense probably benign
R7638:Itga10 UTSW 3 96657391 splice site probably null
R7893:Itga10 UTSW 3 96649612 missense probably damaging 1.00
R8297:Itga10 UTSW 3 96654800 missense probably damaging 1.00
X0064:Itga10 UTSW 3 96652936 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGGACCCTTGGATGTAAGCAG -3'
(R):5'- AGATAAGCGCCCAGAGCATC -3'

Sequencing Primer
(F):5'- CTTGATGACACCCTGGGACATTG -3'
(R):5'- TGTGATGTATACACTACACTCCAGAC -3'
Posted On2019-10-24